\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104131901:

Variant ID: vg1104131901 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4131901
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CTCCCACTGCCCATTGTTGTCCATCATGCTGGAAGCTGGATCTAGTGGGCTGCGTCGTCCCCAGCTCGTCGCCACTTCTCTCTCCCACCGCCCGTCGCCG[T/C]
CCACGACACAAGCTAGATCTCCCCACCACGTCGCCGACTCGTTCCATGGAGCTCCACCACCCTGCCGTCTCCAACTCCTCCCCACCGCACCGCCGGCTCG

Reverse complement sequence

CGAGCCGGCGGTGCGGTGGGGAGGAGTTGGAGACGGCAGGGTGGTGGAGCTCCATGGAACGAGTCGGCGACGTGGTGGGGAGATCTAGCTTGTGTCGTGG[A/G]
CGGCGACGGGCGGTGGGAGAGAGAAGTGGCGACGAGCTGGGGACGACGCAGCCCACTAGATCCAGCTTCCAGCATGATGGACAACAATGGGCAGTGGGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.40% 42.70% 0.02% 0.93% NA
All Indica  2759 81.90% 17.10% 0.04% 1.01% NA
All Japonica  1512 11.80% 87.50% 0.00% 0.66% NA
Aus  269 33.10% 66.90% 0.00% 0.00% NA
Indica I  595 77.60% 19.80% 0.17% 2.35% NA
Indica II  465 95.30% 4.30% 0.00% 0.43% NA
Indica III  913 74.80% 25.00% 0.00% 0.22% NA
Indica Intermediate  786 85.40% 13.40% 0.00% 1.27% NA
Temperate Japonica  767 1.00% 98.70% 0.00% 0.26% NA
Tropical Japonica  504 30.40% 68.70% 0.00% 0.99% NA
Japonica Intermediate  241 7.50% 91.30% 0.00% 1.24% NA
VI/Aromatic  96 88.50% 10.40% 0.00% 1.04% NA
Intermediate  90 58.90% 35.60% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104131901 T -> DEL N N silent_mutation Average:78.955; most accessible tissue: Zhenshan97 panicle, score: 93.133 N N N N
vg1104131901 T -> C LOC_Os11g07960.1 upstream_gene_variant ; 1330.0bp to feature; MODIFIER silent_mutation Average:78.955; most accessible tissue: Zhenshan97 panicle, score: 93.133 N N N N
vg1104131901 T -> C LOC_Os11g07970.1 downstream_gene_variant ; 2428.0bp to feature; MODIFIER silent_mutation Average:78.955; most accessible tissue: Zhenshan97 panicle, score: 93.133 N N N N
vg1104131901 T -> C LOC_Os11g07960-LOC_Os11g07970 intergenic_region ; MODIFIER silent_mutation Average:78.955; most accessible tissue: Zhenshan97 panicle, score: 93.133 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1104131901 T C -0.03 -0.03 -0.02 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104131901 1.89E-06 2.08E-08 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104131901 NA 5.15E-07 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104131901 NA 5.03E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104131901 5.15E-26 7.56E-66 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104131901 2.37E-16 3.24E-19 mr1638 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104131901 2.08E-06 9.75E-09 mr1638 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104131901 NA 6.10E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104131901 NA 7.28E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104131901 NA 5.25E-07 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251