\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104127107:

Variant ID: vg1104127107 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4127107
Reference Allele: CAlternative Allele: T,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGATCATGATTTGGATAAATAATTTAAGAGAAAAATAGTTTAAAGTTCGCTTAGATACATACATGTAGGATGACTTCATCATGACTTGGGCGTCCGATC[C/T,G]
GTAGTCGCCTCAAAAACATATGCAACCAATCTACAAATTATCAATCATTTGATTATTATATATCCGTGTGTGCTGGCAGGGAGAAAACACAAGCAGCTAA

Reverse complement sequence

TTAGCTGCTTGTGTTTTCTCCCTGCCAGCACACACGGATATATAATAATCAAATGATTGATAATTTGTAGATTGGTTGCATATGTTTTTGAGGCGACTAC[G/A,C]
GATCGGACGCCCAAGTCATGATGAAGTCATCCTACATGTATGTATCTAAGCGAACTTTAAACTATTTTTCTCTTAAATTATTTATCCAAATCATGATCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.20% 11.70% 0.06% 0.00% G: 0.04%
All Indica  2759 94.90% 5.00% 0.07% 0.00% G: 0.07%
All Japonica  1512 82.10% 17.80% 0.07% 0.00% NA
Aus  269 51.70% 48.30% 0.00% 0.00% NA
Indica I  595 81.50% 18.30% 0.17% 0.00% NA
Indica II  465 99.60% 0.20% 0.00% 0.00% G: 0.22%
Indica III  913 99.70% 0.20% 0.00% 0.00% G: 0.11%
Indica Intermediate  786 96.60% 3.30% 0.13% 0.00% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 55.80% 44.00% 0.20% 0.00% NA
Japonica Intermediate  241 87.10% 12.90% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104127107 C -> T LOC_Os11g07950.1 upstream_gene_variant ; 3579.0bp to feature; MODIFIER silent_mutation Average:45.923; most accessible tissue: Minghui63 root, score: 79.068 N N N N
vg1104127107 C -> T LOC_Os11g07960.1 downstream_gene_variant ; 1422.0bp to feature; MODIFIER silent_mutation Average:45.923; most accessible tissue: Minghui63 root, score: 79.068 N N N N
vg1104127107 C -> T LOC_Os11g07950-LOC_Os11g07960 intergenic_region ; MODIFIER silent_mutation Average:45.923; most accessible tissue: Minghui63 root, score: 79.068 N N N N
vg1104127107 C -> G LOC_Os11g07950.1 upstream_gene_variant ; 3579.0bp to feature; MODIFIER silent_mutation Average:45.923; most accessible tissue: Minghui63 root, score: 79.068 N N N N
vg1104127107 C -> G LOC_Os11g07960.1 downstream_gene_variant ; 1422.0bp to feature; MODIFIER silent_mutation Average:45.923; most accessible tissue: Minghui63 root, score: 79.068 N N N N
vg1104127107 C -> G LOC_Os11g07950-LOC_Os11g07960 intergenic_region ; MODIFIER silent_mutation Average:45.923; most accessible tissue: Minghui63 root, score: 79.068 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104127107 NA 3.71E-07 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104127107 1.25E-11 NA mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104127107 3.75E-07 1.23E-08 mr1638 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104127107 2.40E-06 NA mr1699 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104127107 8.15E-06 NA mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251