\
| Variant ID: vg1104127107 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4127107 |
| Reference Allele: C | Alternative Allele: T,G |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGGATCATGATTTGGATAAATAATTTAAGAGAAAAATAGTTTAAAGTTCGCTTAGATACATACATGTAGGATGACTTCATCATGACTTGGGCGTCCGATC[C/T,G]
GTAGTCGCCTCAAAAACATATGCAACCAATCTACAAATTATCAATCATTTGATTATTATATATCCGTGTGTGCTGGCAGGGAGAAAACACAAGCAGCTAA
TTAGCTGCTTGTGTTTTCTCCCTGCCAGCACACACGGATATATAATAATCAAATGATTGATAATTTGTAGATTGGTTGCATATGTTTTTGAGGCGACTAC[G/A,C]
GATCGGACGCCCAAGTCATGATGAAGTCATCCTACATGTATGTATCTAAGCGAACTTTAAACTATTTTTCTCTTAAATTATTTATCCAAATCATGATCCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.20% | 11.70% | 0.06% | 0.00% | G: 0.04% |
| All Indica | 2759 | 94.90% | 5.00% | 0.07% | 0.00% | G: 0.07% |
| All Japonica | 1512 | 82.10% | 17.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 51.70% | 48.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.50% | 18.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.00% | 0.00% | G: 0.22% |
| Indica III | 913 | 99.70% | 0.20% | 0.00% | 0.00% | G: 0.11% |
| Indica Intermediate | 786 | 96.60% | 3.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 55.80% | 44.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.10% | 12.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104127107 | C -> T | LOC_Os11g07950.1 | upstream_gene_variant ; 3579.0bp to feature; MODIFIER | silent_mutation | Average:45.923; most accessible tissue: Minghui63 root, score: 79.068 | N | N | N | N |
| vg1104127107 | C -> T | LOC_Os11g07960.1 | downstream_gene_variant ; 1422.0bp to feature; MODIFIER | silent_mutation | Average:45.923; most accessible tissue: Minghui63 root, score: 79.068 | N | N | N | N |
| vg1104127107 | C -> T | LOC_Os11g07950-LOC_Os11g07960 | intergenic_region ; MODIFIER | silent_mutation | Average:45.923; most accessible tissue: Minghui63 root, score: 79.068 | N | N | N | N |
| vg1104127107 | C -> G | LOC_Os11g07950.1 | upstream_gene_variant ; 3579.0bp to feature; MODIFIER | silent_mutation | Average:45.923; most accessible tissue: Minghui63 root, score: 79.068 | N | N | N | N |
| vg1104127107 | C -> G | LOC_Os11g07960.1 | downstream_gene_variant ; 1422.0bp to feature; MODIFIER | silent_mutation | Average:45.923; most accessible tissue: Minghui63 root, score: 79.068 | N | N | N | N |
| vg1104127107 | C -> G | LOC_Os11g07950-LOC_Os11g07960 | intergenic_region ; MODIFIER | silent_mutation | Average:45.923; most accessible tissue: Minghui63 root, score: 79.068 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104127107 | NA | 3.71E-07 | mr1343 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104127107 | 1.25E-11 | NA | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104127107 | 3.75E-07 | 1.23E-08 | mr1638 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104127107 | 2.40E-06 | NA | mr1699 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104127107 | 8.15E-06 | NA | mr1699 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |