Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104020767:

Variant ID: vg1104020767 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4020767
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGAGTAACGGTATACTACAATACTTAAAATATGAGCATGATAAAATCATGGGACATGAAGCCATGAAGCACCTTGACCTCGGGATACATTGTTTCCCAT[G/T]
GATACAGCACCATTTCAGCCCATATTACATGGACCTCTCTTCGTGATGCCTTCCGGACCGAATCACTTGGGCCTCACTTTGCATACGAGCCCATTCCATC

Reverse complement sequence

GATGGAATGGGCTCGTATGCAAAGTGAGGCCCAAGTGATTCGGTCCGGAAGGCATCACGAAGAGAGGTCCATGTAATATGGGCTGAAATGGTGCTGTATC[C/A]
ATGGGAAACAATGTATCCCGAGGTCAAGGTGCTTCATGGCTTCATGTCCCATGATTTTATCATGCTCATATTTTAAGTATTGTAGTATACCGTTACTCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.60%	0.10%	16.69%	22.56%	NA
All Indica	2759	44.20%	0.10%	22.98%	32.73%	NA
All Japonica	1512	90.90%	0.10%	4.17%	4.83%	NA
Aus	269	66.20%	0.40%	22.68%	10.78%	NA
Indica I	595	45.70%	0.20%	29.92%	24.20%	NA
Indica II	465	36.10%	0.20%	28.17%	35.48%	NA
Indica III	913	49.10%	0.00%	14.35%	36.58%	NA
Indica Intermediate	786	42.10%	0.10%	24.68%	33.08%	NA
Temperate Japonica	767	99.10%	0.00%	0.39%	0.52%	NA
Tropical Japonica	504	77.20%	0.40%	10.12%	12.30%	NA
Japonica Intermediate	241	93.40%	0.00%	3.73%	2.90%	NA
VI/Aromatic	96	43.80%	0.00%	20.83%	35.42%	NA
Intermediate	90	57.80%	0.00%	12.22%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104020767	G -> T	LOC_Os11g07870.1	upstream_gene_variant ; 931.0bp to feature; MODIFIER	silent_mutation	Average:98.223; most accessible tissue: Callus, score: 99.245	N	N	N	N
vg1104020767	G -> T	LOC_Os11g07860.1	downstream_gene_variant ; 3813.0bp to feature; MODIFIER	silent_mutation	Average:98.223; most accessible tissue: Callus, score: 99.245	N	N	N	N
vg1104020767	G -> T	LOC_Os11g07860-LOC_Os11g07870	intergenic_region ; MODIFIER	silent_mutation	Average:98.223; most accessible tissue: Callus, score: 99.245	N	N	N	N
vg1104020767	G -> DEL	N	N	silent_mutation	Average:98.223; most accessible tissue: Callus, score: 99.245	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1104020767	G	T	-0.01	0.02	0.01	-0.01	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104020767	NA	3.86E-06	mr1578	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104020767	2.16E-07	2.80E-08	mr1498_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104020767	3.84E-06	3.84E-06	mr1925_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251