\
| Variant ID: vg1103963461 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 3963461 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 46. )
AAGGACCGGTTCGCAGGATGCCCTGGAAGAACTTATCATACTTACCACAAGCCAGCGTGGGCAACGGCTGGGCTTGTAGTGTAGCTTTCCTCTAGTCAAC[T/G]
CATCCAGGCAAGGGTGGGCGTGATGGAGCGGGGCGGGCCCTGTGACGGCCTCTGTCGCTTCCGGATTCACCTAGGCACGAGAGGGGACTGCCCGCTGCCT
AGGCAGCGGGCAGTCCCCTCTCGTGCCTAGGTGAATCCGGAAGCGACAGAGGCCGTCACAGGGCCCGCCCCGCTCCATCACGCCCACCCTTGCCTGGATG[A/C]
GTTGACTAGAGGAAAGCTACACTACAAGCCCAGCCGTTGCCCACGCTGGCTTGTGGTAAGTATGATAAGTTCTTCCAGGGCATCCTGCGAACCGGTCCTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.30% | 3.10% | 9.50% | 55.10% | NA |
| All Indica | 2759 | 6.50% | 5.00% | 14.28% | 74.19% | NA |
| All Japonica | 1512 | 86.80% | 0.10% | 0.33% | 12.76% | NA |
| Aus | 269 | 1.50% | 1.90% | 15.24% | 81.41% | NA |
| Indica I | 595 | 4.20% | 4.00% | 11.43% | 80.34% | NA |
| Indica II | 465 | 6.20% | 3.20% | 11.83% | 78.71% | NA |
| Indica III | 913 | 6.40% | 6.90% | 17.85% | 68.89% | NA |
| Indica Intermediate | 786 | 8.50% | 4.70% | 13.74% | 73.03% | NA |
| Temperate Japonica | 767 | 99.10% | 0.00% | 0.00% | 0.91% | NA |
| Tropical Japonica | 504 | 67.50% | 0.20% | 0.99% | 31.35% | NA |
| Japonica Intermediate | 241 | 88.40% | 0.00% | 0.00% | 11.62% | NA |
| VI/Aromatic | 96 | 3.10% | 0.00% | 4.17% | 92.71% | NA |
| Intermediate | 90 | 32.20% | 0.00% | 5.56% | 62.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1103963461 | T -> DEL | N | N | silent_mutation | Average:14.999; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
| vg1103963461 | T -> G | LOC_Os11g07790.1 | upstream_gene_variant ; 4909.0bp to feature; MODIFIER | silent_mutation | Average:14.999; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
| vg1103963461 | T -> G | LOC_Os11g07770.1 | downstream_gene_variant ; 3600.0bp to feature; MODIFIER | silent_mutation | Average:14.999; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
| vg1103963461 | T -> G | LOC_Os11g07780.1 | downstream_gene_variant ; 163.0bp to feature; MODIFIER | silent_mutation | Average:14.999; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
| vg1103963461 | T -> G | LOC_Os11g07780-LOC_Os11g07790 | intergenic_region ; MODIFIER | silent_mutation | Average:14.999; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1103963461 | NA | 3.17E-10 | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103963461 | NA | 8.65E-06 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103963461 | 3.53E-06 | 2.40E-08 | mr1218 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103963461 | NA | 4.08E-06 | mr1363 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103963461 | NA | 8.79E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103963461 | 2.44E-08 | 4.51E-41 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103963461 | 7.81E-06 | 5.77E-08 | mr1638 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103963461 | NA | 2.73E-06 | mr1732 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103963461 | 1.97E-06 | 1.97E-06 | mr1808 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103963461 | NA | 8.38E-12 | mr1188_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103963461 | NA | 3.30E-07 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103963461 | NA | 2.52E-07 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103963461 | NA | 2.69E-08 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |