\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103963461:

Variant ID: vg1103963461 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 3963461
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 46. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGACCGGTTCGCAGGATGCCCTGGAAGAACTTATCATACTTACCACAAGCCAGCGTGGGCAACGGCTGGGCTTGTAGTGTAGCTTTCCTCTAGTCAAC[T/G]
CATCCAGGCAAGGGTGGGCGTGATGGAGCGGGGCGGGCCCTGTGACGGCCTCTGTCGCTTCCGGATTCACCTAGGCACGAGAGGGGACTGCCCGCTGCCT

Reverse complement sequence

AGGCAGCGGGCAGTCCCCTCTCGTGCCTAGGTGAATCCGGAAGCGACAGAGGCCGTCACAGGGCCCGCCCCGCTCCATCACGCCCACCCTTGCCTGGATG[A/C]
GTTGACTAGAGGAAAGCTACACTACAAGCCCAGCCGTTGCCCACGCTGGCTTGTGGTAAGTATGATAAGTTCTTCCAGGGCATCCTGCGAACCGGTCCTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.30% 3.10% 9.50% 55.10% NA
All Indica  2759 6.50% 5.00% 14.28% 74.19% NA
All Japonica  1512 86.80% 0.10% 0.33% 12.76% NA
Aus  269 1.50% 1.90% 15.24% 81.41% NA
Indica I  595 4.20% 4.00% 11.43% 80.34% NA
Indica II  465 6.20% 3.20% 11.83% 78.71% NA
Indica III  913 6.40% 6.90% 17.85% 68.89% NA
Indica Intermediate  786 8.50% 4.70% 13.74% 73.03% NA
Temperate Japonica  767 99.10% 0.00% 0.00% 0.91% NA
Tropical Japonica  504 67.50% 0.20% 0.99% 31.35% NA
Japonica Intermediate  241 88.40% 0.00% 0.00% 11.62% NA
VI/Aromatic  96 3.10% 0.00% 4.17% 92.71% NA
Intermediate  90 32.20% 0.00% 5.56% 62.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1103963461 T -> DEL N N silent_mutation Average:14.999; most accessible tissue: Minghui63 young leaf, score: 38.036 N N N N
vg1103963461 T -> G LOC_Os11g07790.1 upstream_gene_variant ; 4909.0bp to feature; MODIFIER silent_mutation Average:14.999; most accessible tissue: Minghui63 young leaf, score: 38.036 N N N N
vg1103963461 T -> G LOC_Os11g07770.1 downstream_gene_variant ; 3600.0bp to feature; MODIFIER silent_mutation Average:14.999; most accessible tissue: Minghui63 young leaf, score: 38.036 N N N N
vg1103963461 T -> G LOC_Os11g07780.1 downstream_gene_variant ; 163.0bp to feature; MODIFIER silent_mutation Average:14.999; most accessible tissue: Minghui63 young leaf, score: 38.036 N N N N
vg1103963461 T -> G LOC_Os11g07780-LOC_Os11g07790 intergenic_region ; MODIFIER silent_mutation Average:14.999; most accessible tissue: Minghui63 young leaf, score: 38.036 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1103963461 NA 3.17E-10 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103963461 NA 8.65E-06 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103963461 3.53E-06 2.40E-08 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103963461 NA 4.08E-06 mr1363 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103963461 NA 8.79E-08 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103963461 2.44E-08 4.51E-41 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103963461 7.81E-06 5.77E-08 mr1638 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103963461 NA 2.73E-06 mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103963461 1.97E-06 1.97E-06 mr1808 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103963461 NA 8.38E-12 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103963461 NA 3.30E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103963461 NA 2.52E-07 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103963461 NA 2.69E-08 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251