Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103961340:

Variant ID: vg1103961340 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 3961340
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.62, G: 0.38, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCGGTCACGATGGTGAACCCGCCGGACAACACGTCAAATACCTTGTTCGGGATGGTTGTGGTCCTCGACGACCTACTAACTGTGGGGCCCAATTCGAG[A/G]
TCCAAGCCCGTGGGCCGAGCCCAGGGCATGTACGTCTCGTCAGACCAAACCTGGATCGGGCTCCTGATGGCAACGAACATCATGCTCACCACCTGTCACA

Reverse complement sequence

TGTGACAGGTGGTGAGCATGATGTTCGTTGCCATCAGGAGCCCGATCCAGGTTTGGTCTGACGAGACGTACATGCCCTGGGCTCGGCCCACGGGCTTGGA[T/C]
CTCGAATTGGGCCCCACAGTTAGTAGGTCGTCGAGGACCACAACCATCCCGAACAAGGTATTTGACGTGTTGTCCGGCGGGTTCACCATCGTGACCGCCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.20% 30.30% 1.04% 2.43% NA
All Indica  2759 91.20% 3.90% 1.59% 3.37% NA
All Japonica  1512 12.60% 86.20% 0.07% 1.12% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.50% 0.30% 1.18% 0.00% NA
Indica II  465 95.90% 3.00% 1.08% 0.00% NA
Indica III  913 82.50% 5.40% 2.52% 9.64% NA
Indica Intermediate  786 92.90% 5.30% 1.15% 0.64% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 31.30% 65.90% 0.20% 2.58% NA
Japonica Intermediate  241 10.00% 88.40% 0.00% 1.66% NA
VI/Aromatic  96 93.80% 2.10% 0.00% 4.17% NA
Intermediate  90 73.30% 21.10% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1103961340 A -> DEL N N silent_mutation Average:69.711; most accessible tissue: Minghui63 young leaf, score: 80.883 N N N N
vg1103961340 A -> G LOC_Os11g07760.1 upstream_gene_variant ; 4667.0bp to feature; MODIFIER silent_mutation Average:69.711; most accessible tissue: Minghui63 young leaf, score: 80.883 N N N N
vg1103961340 A -> G LOC_Os11g07770.1 downstream_gene_variant ; 1479.0bp to feature; MODIFIER silent_mutation Average:69.711; most accessible tissue: Minghui63 young leaf, score: 80.883 N N N N
vg1103961340 A -> G LOC_Os11g07780.1 intron_variant ; MODIFIER silent_mutation Average:69.711; most accessible tissue: Minghui63 young leaf, score: 80.883 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1103961340 NA 1.33E-11 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103961340 NA 1.27E-07 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103961340 NA 2.07E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103961340 8.71E-06 NA mr1627 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103961340 NA 4.62E-13 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103961340 1.79E-07 1.71E-36 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103961340 7.85E-06 4.55E-08 mr1638 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103961340 NA 4.81E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103961340 NA 5.66E-11 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103961340 NA 6.98E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103961340 NA 5.99E-06 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103961340 NA 1.30E-06 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103961340 NA 1.14E-19 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251