\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103886177:

Variant ID: vg1103886177 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 3886177
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


CCCACCTCCTCCCTCTCCCTTTCACCCTCCTCCTCCCATCTCCCGGCAACGGCAGCGGTGGCGGCCTCGGCTAGGGCGGCGGAGGTGGCGGCATCGGGTT[G/A]
GAGCAGCGGAGGCAGCGGCGGAGGCGAGTGCGGCATCAGCCATGGTGGGGGCGGCGGAGCGGATCCGTCGCCGGCGACCGCGGGGAGGCTAGATCCGTCG

Reverse complement sequence

CGACGGATCTAGCCTCCCCGCGGTCGCCGGCGACGGATCCGCTCCGCCGCCCCCACCATGGCTGATGCCGCACTCGCCTCCGCCGCTGCCTCCGCTGCTC[C/T]
AACCCGATGCCGCCACCTCCGCCGCCCTAGCCGAGGCCGCCACCGCTGCCGTTGCCGGGAGATGGGAGGAGGAGGGTGAAAGGGAGAGGGAGGAGGTGGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.00% 18.90% 0.17% 0.00% NA
All Indica  2759 97.30% 2.60% 0.11% 0.00% NA
All Japonica  1512 46.20% 53.40% 0.33% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 96.10% 3.80% 0.11% 0.00% NA
Indica Intermediate  786 96.90% 2.80% 0.25% 0.00% NA
Temperate Japonica  767 9.90% 90.10% 0.00% 0.00% NA
Tropical Japonica  504 93.10% 6.70% 0.20% 0.00% NA
Japonica Intermediate  241 63.90% 34.40% 1.66% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1103886177 G -> A LOC_Os11g07620.1 upstream_gene_variant ; 177.0bp to feature; MODIFIER silent_mutation Average:76.351; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg1103886177 G -> A LOC_Os11g07630.1 downstream_gene_variant ; 2918.0bp to feature; MODIFIER silent_mutation Average:76.351; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg1103886177 G -> A LOC_Os11g07600-LOC_Os11g07620 intergenic_region ; MODIFIER silent_mutation Average:76.351; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1103886177 NA 5.20E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177 NA 2.72E-23 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177 NA 2.96E-10 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177 NA 3.48E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177 NA 2.04E-08 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177 NA 1.02E-08 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177 NA 1.13E-12 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177 NA 1.51E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177 NA 1.11E-07 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177 NA 3.15E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177 NA 8.60E-07 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177 NA 1.91E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177 NA 1.20E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177 4.47E-06 NA mr1546_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177 9.94E-07 7.70E-06 mr1546_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177 NA 3.77E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177 NA 8.59E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177 NA 2.15E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177 NA 2.55E-09 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177 NA 1.62E-07 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251