Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103886177:

Variant ID: vg1103886177 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 3886177
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

CCCACCTCCTCCCTCTCCCTTTCACCCTCCTCCTCCCATCTCCCGGCAACGGCAGCGGTGGCGGCCTCGGCTAGGGCGGCGGAGGTGGCGGCATCGGGTT[G/A]
GAGCAGCGGAGGCAGCGGCGGAGGCGAGTGCGGCATCAGCCATGGTGGGGGCGGCGGAGCGGATCCGTCGCCGGCGACCGCGGGGAGGCTAGATCCGTCG

Reverse complement sequence

CGACGGATCTAGCCTCCCCGCGGTCGCCGGCGACGGATCCGCTCCGCCGCCCCCACCATGGCTGATGCCGCACTCGCCTCCGCCGCTGCCTCCGCTGCTC[C/T]
AACCCGATGCCGCCACCTCCGCCGCCCTAGCCGAGGCCGCCACCGCTGCCGTTGCCGGGAGATGGGAGGAGGAGGGTGAAAGGGAGAGGGAGGAGGTGGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.00%	18.90%	0.17%	0.00%	NA
All Indica	2759	97.30%	2.60%	0.11%	0.00%	NA
All Japonica	1512	46.20%	53.40%	0.33%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	97.00%	3.00%	0.00%	0.00%	NA
Indica III	913	96.10%	3.80%	0.11%	0.00%	NA
Indica Intermediate	786	96.90%	2.80%	0.25%	0.00%	NA
Temperate Japonica	767	9.90%	90.10%	0.00%	0.00%	NA
Tropical Japonica	504	93.10%	6.70%	0.20%	0.00%	NA
Japonica Intermediate	241	63.90%	34.40%	1.66%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1103886177	G -> A	LOC_Os11g07620.1	upstream_gene_variant ; 177.0bp to feature; MODIFIER	silent_mutation	Average:76.351; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N
vg1103886177	G -> A	LOC_Os11g07630.1	downstream_gene_variant ; 2918.0bp to feature; MODIFIER	silent_mutation	Average:76.351; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N
vg1103886177	G -> A	LOC_Os11g07600-LOC_Os11g07620	intergenic_region ; MODIFIER	silent_mutation	Average:76.351; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1103886177	NA	5.20E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177	NA	2.72E-23	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177	NA	2.96E-10	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177	NA	3.48E-10	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177	NA	2.04E-08	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177	NA	1.02E-08	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177	NA	1.13E-12	mr1844	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177	NA	1.51E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177	NA	1.11E-07	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177	NA	3.15E-06	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177	NA	8.60E-07	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177	NA	1.91E-06	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177	NA	1.20E-10	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177	4.47E-06	NA	mr1546_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177	9.94E-07	7.70E-06	mr1546_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177	NA	3.77E-09	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177	NA	8.59E-09	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177	NA	2.15E-07	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177	NA	2.55E-09	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103886177	NA	1.62E-07	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251