\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103861273:

Variant ID: vg1103861273 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 3861273
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACGACTTTTTTTTATGAGTATGGAGGGAGTACATATATGTTGTCATGCCAAGTACGTAAGGGCACCCACAATGGTAAAGTAAGGTGCTCTCTATAAAA[T/C]
ATGTACATCTCAGCAATAGACTAGATTAATAGTAAATCACCTCAGTAGTATGTCTACACGGGTATTTATAGCTCTCTAATCCATTGCCTTGTTTTTCTCT

Reverse complement sequence

AGAGAAAAACAAGGCAATGGATTAGAGAGCTATAAATACCCGTGTAGACATACTACTGAGGTGATTTACTATTAATCTAGTCTATTGCTGAGATGTACAT[A/G]
TTTTATAGAGAGCACCTTACTTTACCATTGTGGGTGCCCTTACGTACTTGGCATGACAACATATATGTACTCCCTCCATACTCATAAAAAAAAGTCGTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.70% 26.00% 0.06% 0.21% NA
All Indica  2759 99.50% 0.40% 0.00% 0.11% NA
All Japonica  1512 20.60% 78.90% 0.20% 0.26% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.00% 0.00% 0.38% NA
Temperate Japonica  767 1.60% 98.00% 0.13% 0.26% NA
Tropical Japonica  504 54.00% 45.60% 0.40% 0.00% NA
Japonica Intermediate  241 11.60% 87.60% 0.00% 0.83% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 74.40% 22.20% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1103861273 T -> DEL N N silent_mutation Average:41.067; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N
vg1103861273 T -> C LOC_Os11g07600.1 upstream_gene_variant ; 3991.0bp to feature; MODIFIER silent_mutation Average:41.067; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N
vg1103861273 T -> C LOC_Os11g07600-LOC_Os11g07620 intergenic_region ; MODIFIER silent_mutation Average:41.067; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1103861273 NA 1.82E-55 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1103861273 NA 5.97E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103861273 NA 2.20E-85 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103861273 NA 1.54E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103861273 NA 8.84E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103861273 NA 7.56E-28 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103861273 NA 6.27E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103861273 NA 8.87E-16 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103861273 NA 6.09E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103861273 NA 6.87E-11 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103861273 NA 2.92E-16 mr1217_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103861273 NA 1.97E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103861273 NA 2.51E-22 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103861273 NA 3.04E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103861273 NA 2.99E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103861273 NA 2.88E-30 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103861273 NA 5.23E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103861273 NA 1.75E-19 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103861273 NA 6.58E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103861273 NA 1.32E-07 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103861273 NA 6.89E-54 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251