\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103858928:

Variant ID: vg1103858928 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 3858928
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTTTGGATCATCCTAATAAATATAATGCATGCATCCAATAGGATTAGATAGCATGAGAGTGAATGATTTAAAAAAGTAAAAGTTTAATGGAGAAGATG[T/C]
CATAGTTAATTACATGCTTGCATGTATGCCTTATATTATGGAACCTCTAAGAAAAGTGGTTGTGCCTTATATTATAGAATGGAGGGAGTATTAATTACTC

Reverse complement sequence

GAGTAATTAATACTCCCTCCATTCTATAATATAAGGCACAACCACTTTTCTTAGAGGTTCCATAATATAAGGCATACATGCAAGCATGTAATTAACTATG[A/G]
CATCTTCTCCATTAAACTTTTACTTTTTTAAATCATTCACTCTCATGCTATCTAATCCTATTGGATGCATGCATTATATTTATTAGGATGATCCAAACTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 40.80% 0.15% 0.28% NA
All Indica  2759 74.60% 25.20% 0.11% 0.14% NA
All Japonica  1512 20.40% 79.00% 0.20% 0.33% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 45.20% 54.80% 0.00% 0.00% NA
Indica II  465 95.90% 4.10% 0.00% 0.00% NA
Indica III  913 84.60% 15.30% 0.11% 0.00% NA
Indica Intermediate  786 72.60% 26.60% 0.25% 0.51% NA
Temperate Japonica  767 1.30% 98.30% 0.13% 0.26% NA
Tropical Japonica  504 54.00% 45.40% 0.40% 0.20% NA
Japonica Intermediate  241 11.20% 88.00% 0.00% 0.83% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 62.20% 32.20% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1103858928 T -> DEL N N silent_mutation Average:52.19; most accessible tissue: Callus, score: 82.322 N N N N
vg1103858928 T -> C LOC_Os11g07600.1 upstream_gene_variant ; 1646.0bp to feature; MODIFIER silent_mutation Average:52.19; most accessible tissue: Callus, score: 82.322 N N N N
vg1103858928 T -> C LOC_Os11g07600-LOC_Os11g07620 intergenic_region ; MODIFIER silent_mutation Average:52.19; most accessible tissue: Callus, score: 82.322 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1103858928 NA 7.90E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103858928 NA 2.04E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103858928 NA 8.30E-10 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103858928 NA 2.65E-10 mr1633 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103858928 NA 1.33E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103858928 NA 2.73E-09 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103858928 NA 5.15E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103858928 NA 4.68E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103858928 NA 2.76E-06 mr1633_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103858928 NA 2.17E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103858928 NA 2.43E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103858928 NA 2.76E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103858928 NA 7.17E-07 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251