\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103833072:

Variant ID: vg1103833072 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 3833072
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAAATTTATGCAATTATCATTTATTTTATTGTGACTTGATTTGTCATCAAATATTCTTTAAGCATGACATAAATATTTTCATATTTACATAAAAATTT[A/G]
AATAAAACGAATGGTCAAACATTAGTCGAAAAGTCAACGGTGTCGTACATTCAAATATGGAGGGAGTACTAATGTAACGTCCCGCCTCCCCCAGGCCGGG

Reverse complement sequence

CCCGGCCTGGGGGAGGCGGGACGTTACATTAGTACTCCCTCCATATTTGAATGTACGACACCGTTGACTTTTCGACTAATGTTTGACCATTCGTTTTATT[T/C]
AAATTTTTATGTAAATATGAAAATATTTATGTCATGCTTAAAGAATATTTGATGACAAATCAAGTCACAATAAAATAAATGATAATTGCATAAATTTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.00% 26.80% 0.25% 0.00% NA
All Indica  2759 98.50% 1.20% 0.36% 0.00% NA
All Japonica  1512 20.40% 79.50% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.50% 0.80% 0.67% 0.00% NA
Indica II  465 98.10% 1.70% 0.22% 0.00% NA
Indica III  913 99.20% 0.50% 0.22% 0.00% NA
Indica Intermediate  786 97.80% 1.80% 0.38% 0.00% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 53.60% 46.40% 0.00% 0.00% NA
Japonica Intermediate  241 11.20% 88.40% 0.41% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1103833072 A -> G LOC_Os11g07560.1 upstream_gene_variant ; 4829.0bp to feature; MODIFIER silent_mutation Average:74.459; most accessible tissue: Minghui63 root, score: 87.964 N N N N
vg1103833072 A -> G LOC_Os11g07570.1 downstream_gene_variant ; 1651.0bp to feature; MODIFIER silent_mutation Average:74.459; most accessible tissue: Minghui63 root, score: 87.964 N N N N
vg1103833072 A -> G LOC_Os11g07580.1 downstream_gene_variant ; 981.0bp to feature; MODIFIER silent_mutation Average:74.459; most accessible tissue: Minghui63 root, score: 87.964 N N N N
vg1103833072 A -> G LOC_Os11g07570-LOC_Os11g07580 intergenic_region ; MODIFIER silent_mutation Average:74.459; most accessible tissue: Minghui63 root, score: 87.964 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1103833072 A G -0.04 -0.01 -0.02 -0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1103833072 NA 5.94E-54 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1103833072 NA 6.50E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103833072 NA 1.09E-13 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103833072 NA 1.05E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103833072 NA 4.71E-30 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103833072 NA 6.25E-15 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103833072 NA 2.23E-41 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103833072 7.69E-06 NA mr1526_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103833072 NA 2.54E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103833072 NA 1.40E-06 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251