\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103575914:

Variant ID: vg1103575914 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 3575914
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, C: 0.08, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTCGCGTGGAGGAGACGTGGGTTCCCAACCCGAAGGAGCTAACAGAGTGTTAGCTTGCTTTTCATCGCATGTGCCATTATGGAGCATAGTACTTCCAA[G/C]
CTAGTGTAAGACTCTGCATCTAATTAGGTTTCAAAAATAAAAGACTCTGCATCTAAAACCTGCATTAACTAGAGGGATCAGTTCCTCAGACGAAGACGGG

Reverse complement sequence

CCCGTCTTCGTCTGAGGAACTGATCCCTCTAGTTAATGCAGGTTTTAGATGCAGAGTCTTTTATTTTTGAAACCTAATTAGATGCAGAGTCTTACACTAG[C/G]
TTGGAAGTACTATGCTCCATAATGGCACATGCGATGAAAAGCAAGCTAACACTCTGTTAGCTCCTTCGGGTTGGGAACCCACGTCTCCTCCACGCGAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.30% 47.90% 0.17% 2.56% NA
All Indica  2759 69.60% 28.30% 0.18% 1.99% NA
All Japonica  1512 8.90% 91.10% 0.00% 0.00% NA
Aus  269 71.00% 4.10% 0.74% 24.16% NA
Indica I  595 95.00% 1.20% 0.17% 3.70% NA
Indica II  465 33.80% 65.80% 0.22% 0.22% NA
Indica III  913 75.50% 22.80% 0.11% 1.64% NA
Indica Intermediate  786 64.60% 33.00% 0.25% 2.16% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 21.20% 78.80% 0.00% 0.00% NA
Japonica Intermediate  241 7.50% 92.50% 0.00% 0.00% NA
VI/Aromatic  96 53.10% 46.90% 0.00% 0.00% NA
Intermediate  90 41.10% 56.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1103575914 G -> DEL N N silent_mutation Average:46.34; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N
vg1103575914 G -> C LOC_Os11g07160-LOC_Os11g07170 intergenic_region ; MODIFIER silent_mutation Average:46.34; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1103575914 NA 4.34E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103575914 NA 1.13E-06 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103575914 NA 8.77E-07 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103575914 NA 1.55E-06 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103575914 NA 5.23E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103575914 2.66E-06 5.15E-15 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103575914 4.42E-06 2.64E-12 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103575914 NA 3.65E-08 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103575914 NA 1.98E-09 mr1944 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103575914 NA 5.31E-06 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103575914 NA 6.50E-08 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103575914 NA 4.26E-10 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103575914 NA 3.63E-07 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103575914 NA 2.34E-11 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103575914 NA 3.07E-09 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103575914 NA 9.18E-07 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103575914 NA 4.85E-10 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103575914 NA 4.55E-13 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103575914 NA 1.00E-06 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251