\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103560667:

Variant ID: vg1103560667 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 3560667
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


AGACGTATCAGCTACGCCGCGCTGAACCAATAGCCCAAAAACTGAATCGTTTTCCCTGCCTCTGACCTACTCTCTCCGTTAAAAAAAAAATCTAGAATAG[G/A]
TGTAACATATTATAGAACAACGAATTTGAACAGATGTATAGCTGTGTTTAGTTCAGCGCAAAGTTTGGATTTTGGTTGAAATTGGAGATGATGTGACTGA

Reverse complement sequence

TCAGTCACATCATCTCCAATTTCAACCAAAATCCAAACTTTGCGCTGAACTAAACACAGCTATACATCTGTTCAAATTCGTTGTTCTATAATATGTTACA[C/T]
CTATTCTAGATTTTTTTTTTAACGGAGAGAGTAGGTCAGAGGCAGGGAAAACGATTCAGTTTTTGGGCTATTGGTTCAGCGCGGCGTAGCTGATACGTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.00% 11.30% 0.13% 2.52% NA
All Indica  2759 81.20% 16.70% 0.07% 2.03% NA
All Japonica  1512 96.20% 3.80% 0.00% 0.00% NA
Aus  269 74.70% 0.70% 1.49% 23.05% NA
Indica I  595 96.00% 0.20% 0.00% 3.87% NA
Indica II  465 40.40% 59.40% 0.00% 0.22% NA
Indica III  913 93.80% 4.50% 0.00% 1.75% NA
Indica Intermediate  786 79.60% 18.10% 0.25% 2.04% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 90.10% 9.90% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1103560667 G -> A LOC_Os11g07140.1 downstream_gene_variant ; 2794.0bp to feature; MODIFIER silent_mutation Average:54.478; most accessible tissue: Minghui63 flower, score: 65.9 N N N N
vg1103560667 G -> A LOC_Os11g07150.1 downstream_gene_variant ; 2930.0bp to feature; MODIFIER silent_mutation Average:54.478; most accessible tissue: Minghui63 flower, score: 65.9 N N N N
vg1103560667 G -> A LOC_Os11g07140-LOC_Os11g07150 intergenic_region ; MODIFIER silent_mutation Average:54.478; most accessible tissue: Minghui63 flower, score: 65.9 N N N N
vg1103560667 G -> DEL N N silent_mutation Average:54.478; most accessible tissue: Minghui63 flower, score: 65.9 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1103560667 NA 1.44E-12 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1103560667 NA 6.48E-09 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667 NA 1.46E-10 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667 NA 1.72E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667 NA 7.53E-07 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667 NA 7.89E-10 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667 NA 4.31E-07 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667 NA 6.50E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667 NA 1.28E-07 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667 NA 1.95E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667 NA 8.20E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667 NA 5.30E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667 NA 7.76E-11 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667 NA 9.37E-10 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667 NA 3.40E-09 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667 3.61E-06 3.61E-06 mr1848_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251