\
| Variant ID: vg1103560667 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 3560667 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 84. )
AGACGTATCAGCTACGCCGCGCTGAACCAATAGCCCAAAAACTGAATCGTTTTCCCTGCCTCTGACCTACTCTCTCCGTTAAAAAAAAAATCTAGAATAG[G/A]
TGTAACATATTATAGAACAACGAATTTGAACAGATGTATAGCTGTGTTTAGTTCAGCGCAAAGTTTGGATTTTGGTTGAAATTGGAGATGATGTGACTGA
TCAGTCACATCATCTCCAATTTCAACCAAAATCCAAACTTTGCGCTGAACTAAACACAGCTATACATCTGTTCAAATTCGTTGTTCTATAATATGTTACA[C/T]
CTATTCTAGATTTTTTTTTTAACGGAGAGAGTAGGTCAGAGGCAGGGAAAACGATTCAGTTTTTGGGCTATTGGTTCAGCGCGGCGTAGCTGATACGTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.00% | 11.30% | 0.13% | 2.52% | NA |
| All Indica | 2759 | 81.20% | 16.70% | 0.07% | 2.03% | NA |
| All Japonica | 1512 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 74.70% | 0.70% | 1.49% | 23.05% | NA |
| Indica I | 595 | 96.00% | 0.20% | 0.00% | 3.87% | NA |
| Indica II | 465 | 40.40% | 59.40% | 0.00% | 0.22% | NA |
| Indica III | 913 | 93.80% | 4.50% | 0.00% | 1.75% | NA |
| Indica Intermediate | 786 | 79.60% | 18.10% | 0.25% | 2.04% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.10% | 9.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 16.70% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1103560667 | G -> A | LOC_Os11g07140.1 | downstream_gene_variant ; 2794.0bp to feature; MODIFIER | silent_mutation | Average:54.478; most accessible tissue: Minghui63 flower, score: 65.9 | N | N | N | N |
| vg1103560667 | G -> A | LOC_Os11g07150.1 | downstream_gene_variant ; 2930.0bp to feature; MODIFIER | silent_mutation | Average:54.478; most accessible tissue: Minghui63 flower, score: 65.9 | N | N | N | N |
| vg1103560667 | G -> A | LOC_Os11g07140-LOC_Os11g07150 | intergenic_region ; MODIFIER | silent_mutation | Average:54.478; most accessible tissue: Minghui63 flower, score: 65.9 | N | N | N | N |
| vg1103560667 | G -> DEL | N | N | silent_mutation | Average:54.478; most accessible tissue: Minghui63 flower, score: 65.9 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1103560667 | NA | 1.44E-12 | Grain_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1103560667 | NA | 6.48E-09 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103560667 | NA | 1.46E-10 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103560667 | NA | 1.72E-06 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103560667 | NA | 7.53E-07 | mr1944 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103560667 | NA | 7.89E-10 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103560667 | NA | 4.31E-07 | mr1174_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103560667 | NA | 6.50E-07 | mr1330_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103560667 | NA | 1.28E-07 | mr1360_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103560667 | NA | 1.95E-06 | mr1360_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103560667 | NA | 8.20E-06 | mr1497_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103560667 | NA | 5.30E-09 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103560667 | NA | 7.76E-11 | mr1565_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103560667 | NA | 9.37E-10 | mr1565_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103560667 | NA | 3.40E-09 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103560667 | 3.61E-06 | 3.61E-06 | mr1848_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |