Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103554998:

Variant ID: vg1103554998 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 3554998
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

TTGTTTCACCTATATAAAAACAATGTTTTAGCAAATAGCGAAAGAATGTTTCAGATCACTGCAACATTTGATCCATACATAGTGAAACATTATAAGTACA[C/T]
TAGGTGAAACATTTTTGGTGGAACAAAAATTGAAATGAATTCCCTTAATAAAGGGTTTCCATAATATGTAGGTGATTTGTTGCAAAAGAATGTTTCAATT

Reverse complement sequence

AATTGAAACATTCTTTTGCAACAAATCACCTACATATTATGGAAACCCTTTATTAAGGGAATTCATTTCAATTTTTGTTCCACCAAAAATGTTTCACCTA[G/A]
TGTACTTATAATGTTTCACTATGTATGGATCAAATGTTGCAGTGATCTGAAACATTCTTTCGCTATTTGCTAAAACATTGTTTTTATATAGGTGAAACAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.50%	20.30%	7.13%	12.08%	NA
All Indica	2759	41.90%	27.20%	11.13%	19.79%	NA
All Japonica	1512	92.90%	5.10%	1.26%	0.79%	NA
Aus	269	69.50%	30.50%	0.00%	0.00%	NA
Indica I	595	47.10%	14.80%	11.09%	27.06%	NA
Indica II	465	23.70%	28.20%	15.91%	32.26%	NA
Indica III	913	51.40%	33.40%	7.45%	7.78%	NA
Indica Intermediate	786	37.80%	28.80%	12.60%	20.87%	NA
Temperate Japonica	767	98.40%	0.00%	0.91%	0.65%	NA
Tropical Japonica	504	82.10%	14.70%	1.98%	1.19%	NA
Japonica Intermediate	241	97.50%	1.20%	0.83%	0.41%	NA
VI/Aromatic	96	56.20%	35.40%	7.29%	1.04%	NA
Intermediate	90	64.40%	17.80%	4.44%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1103554998	C -> T	LOC_Os11g07130.1	upstream_gene_variant ; 1066.0bp to feature; MODIFIER	silent_mutation	Average:19.211; most accessible tissue: Callus, score: 29.177	N	N	N	N
vg1103554998	C -> T	LOC_Os11g07140.1	upstream_gene_variant ; 765.0bp to feature; MODIFIER	silent_mutation	Average:19.211; most accessible tissue: Callus, score: 29.177	N	N	N	N
vg1103554998	C -> T	LOC_Os11g07124.1	downstream_gene_variant ; 2644.0bp to feature; MODIFIER	silent_mutation	Average:19.211; most accessible tissue: Callus, score: 29.177	N	N	N	N
vg1103554998	C -> T	LOC_Os11g07130-LOC_Os11g07140	intergenic_region ; MODIFIER	silent_mutation	Average:19.211; most accessible tissue: Callus, score: 29.177	N	N	N	N
vg1103554998	C -> DEL	N	N	silent_mutation	Average:19.211; most accessible tissue: Callus, score: 29.177	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1103554998	2.45E-06	5.05E-06	mr1831	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103554998	1.60E-06	1.60E-06	mr1831	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251