\
| Variant ID: vg1103515499 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 3515499 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTATAACAATATAAAAATATTGGGTTTTTCAACTACTGACTTTTAATTTATTTTTTAGATTATATGACTACATACTCTCAAAATATAGGTGAGAACCTAT[A/G]
CCGTTTAGAAAGCTAAAGATTCTAGAAGTTGTAGCTACCATAAACTCCCCAAACAAAGGCAAAGTTTGATGTTGAAAATTTAAGGATGAATAGTCAGTTC
GAACTGACTATTCATCCTTAAATTTTCAACATCAAACTTTGCCTTTGTTTGGGGAGTTTATGGTAGCTACAACTTCTAGAATCTTTAGCTTTCTAAACGG[T/C]
ATAGGTTCTCACCTATATTTTGAGAGTATGTAGTCATATAATCTAAAAAATAAATTAAAAGTCAGTAGTTGAAAAACCCAATATTTTTATATTGTTATAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.60% | 13.20% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 60.80% | 38.50% | 0.73% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 72.80% | 26.20% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 36.50% | 63.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.40% | 25.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1103515499 | A -> G | LOC_Os11g07050.1 | upstream_gene_variant ; 2719.0bp to feature; MODIFIER | silent_mutation | Average:30.526; most accessible tissue: Callus, score: 78.72 | N | N | N | N |
| vg1103515499 | A -> G | LOC_Os11g07060.1 | upstream_gene_variant ; 2293.0bp to feature; MODIFIER | silent_mutation | Average:30.526; most accessible tissue: Callus, score: 78.72 | N | N | N | N |
| vg1103515499 | A -> G | LOC_Os11g07060.2 | upstream_gene_variant ; 1514.0bp to feature; MODIFIER | silent_mutation | Average:30.526; most accessible tissue: Callus, score: 78.72 | N | N | N | N |
| vg1103515499 | A -> G | LOC_Os11g07060.3 | upstream_gene_variant ; 2293.0bp to feature; MODIFIER | silent_mutation | Average:30.526; most accessible tissue: Callus, score: 78.72 | N | N | N | N |
| vg1103515499 | A -> G | LOC_Os11g07060.4 | upstream_gene_variant ; 2293.0bp to feature; MODIFIER | silent_mutation | Average:30.526; most accessible tissue: Callus, score: 78.72 | N | N | N | N |
| vg1103515499 | A -> G | LOC_Os11g07060.5 | upstream_gene_variant ; 2293.0bp to feature; MODIFIER | silent_mutation | Average:30.526; most accessible tissue: Callus, score: 78.72 | N | N | N | N |
| vg1103515499 | A -> G | LOC_Os11g07050-LOC_Os11g07060 | intergenic_region ; MODIFIER | silent_mutation | Average:30.526; most accessible tissue: Callus, score: 78.72 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1103515499 | NA | 1.11E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103515499 | 5.20E-08 | NA | mr1107 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103515499 | NA | 4.19E-06 | mr1107 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103515499 | 2.48E-07 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103515499 | NA | 5.09E-07 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103515499 | NA | 9.89E-07 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103515499 | NA | 5.23E-12 | mr1949 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103515499 | NA | 9.48E-06 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103515499 | 5.01E-07 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103515499 | 2.78E-09 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103515499 | NA | 1.05E-06 | mr1107_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103515499 | 3.99E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103515499 | NA | 2.64E-06 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103515499 | NA | 1.63E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |