Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1103515499:

Variant ID: vg1103515499 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 3515499
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTATAACAATATAAAAATATTGGGTTTTTCAACTACTGACTTTTAATTTATTTTTTAGATTATATGACTACATACTCTCAAAATATAGGTGAGAACCTAT[A/G]
CCGTTTAGAAAGCTAAAGATTCTAGAAGTTGTAGCTACCATAAACTCCCCAAACAAAGGCAAAGTTTGATGTTGAAAATTTAAGGATGAATAGTCAGTTC

Reverse complement sequence

GAACTGACTATTCATCCTTAAATTTTCAACATCAAACTTTGCCTTTGTTTGGGGAGTTTATGGTAGCTACAACTTCTAGAATCTTTAGCTTTCTAAACGG[T/C]
ATAGGTTCTCACCTATATTTTGAGAGTATGTAGTCATATAATCTAAAAAATAAATTAAAAGTCAGTAGTTGAAAAACCCAATATTTTTATATTGTTATAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.60%	13.20%	0.23%	0.00%	NA
All Indica	2759	99.20%	0.80%	0.00%	0.00%	NA
All Japonica	1512	60.80%	38.50%	0.73%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	97.70%	2.30%	0.00%	0.00%	NA
Temperate Japonica	767	72.80%	26.20%	1.04%	0.00%	NA
Tropical Japonica	504	36.50%	63.30%	0.20%	0.00%	NA
Japonica Intermediate	241	73.40%	25.70%	0.83%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1103515499	A -> G	LOC_Os11g07050.1	upstream_gene_variant ; 2719.0bp to feature; MODIFIER	silent_mutation	Average:30.526; most accessible tissue: Callus, score: 78.72	N	N	N	N
vg1103515499	A -> G	LOC_Os11g07060.1	upstream_gene_variant ; 2293.0bp to feature; MODIFIER	silent_mutation	Average:30.526; most accessible tissue: Callus, score: 78.72	N	N	N	N
vg1103515499	A -> G	LOC_Os11g07060.2	upstream_gene_variant ; 1514.0bp to feature; MODIFIER	silent_mutation	Average:30.526; most accessible tissue: Callus, score: 78.72	N	N	N	N
vg1103515499	A -> G	LOC_Os11g07060.3	upstream_gene_variant ; 2293.0bp to feature; MODIFIER	silent_mutation	Average:30.526; most accessible tissue: Callus, score: 78.72	N	N	N	N
vg1103515499	A -> G	LOC_Os11g07060.4	upstream_gene_variant ; 2293.0bp to feature; MODIFIER	silent_mutation	Average:30.526; most accessible tissue: Callus, score: 78.72	N	N	N	N
vg1103515499	A -> G	LOC_Os11g07060.5	upstream_gene_variant ; 2293.0bp to feature; MODIFIER	silent_mutation	Average:30.526; most accessible tissue: Callus, score: 78.72	N	N	N	N
vg1103515499	A -> G	LOC_Os11g07050-LOC_Os11g07060	intergenic_region ; MODIFIER	silent_mutation	Average:30.526; most accessible tissue: Callus, score: 78.72	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1103515499	NA	1.11E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499	5.20E-08	NA	mr1107	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499	NA	4.19E-06	mr1107	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499	2.48E-07	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499	NA	5.09E-07	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499	NA	9.89E-07	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499	NA	5.23E-12	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499	NA	9.48E-06	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499	5.01E-07	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499	2.78E-09	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499	NA	1.05E-06	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499	3.99E-06	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499	NA	2.64E-06	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499	NA	1.63E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251