\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103515499:

Variant ID: vg1103515499 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 3515499
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATAACAATATAAAAATATTGGGTTTTTCAACTACTGACTTTTAATTTATTTTTTAGATTATATGACTACATACTCTCAAAATATAGGTGAGAACCTAT[A/G]
CCGTTTAGAAAGCTAAAGATTCTAGAAGTTGTAGCTACCATAAACTCCCCAAACAAAGGCAAAGTTTGATGTTGAAAATTTAAGGATGAATAGTCAGTTC

Reverse complement sequence

GAACTGACTATTCATCCTTAAATTTTCAACATCAAACTTTGCCTTTGTTTGGGGAGTTTATGGTAGCTACAACTTCTAGAATCTTTAGCTTTCTAAACGG[T/C]
ATAGGTTCTCACCTATATTTTGAGAGTATGTAGTCATATAATCTAAAAAATAAATTAAAAGTCAGTAGTTGAAAAACCCAATATTTTTATATTGTTATAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.60% 13.20% 0.23% 0.00% NA
All Indica  2759 99.20% 0.80% 0.00% 0.00% NA
All Japonica  1512 60.80% 38.50% 0.73% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 2.30% 0.00% 0.00% NA
Temperate Japonica  767 72.80% 26.20% 1.04% 0.00% NA
Tropical Japonica  504 36.50% 63.30% 0.20% 0.00% NA
Japonica Intermediate  241 73.40% 25.70% 0.83% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1103515499 A -> G LOC_Os11g07050.1 upstream_gene_variant ; 2719.0bp to feature; MODIFIER silent_mutation Average:30.526; most accessible tissue: Callus, score: 78.72 N N N N
vg1103515499 A -> G LOC_Os11g07060.1 upstream_gene_variant ; 2293.0bp to feature; MODIFIER silent_mutation Average:30.526; most accessible tissue: Callus, score: 78.72 N N N N
vg1103515499 A -> G LOC_Os11g07060.2 upstream_gene_variant ; 1514.0bp to feature; MODIFIER silent_mutation Average:30.526; most accessible tissue: Callus, score: 78.72 N N N N
vg1103515499 A -> G LOC_Os11g07060.3 upstream_gene_variant ; 2293.0bp to feature; MODIFIER silent_mutation Average:30.526; most accessible tissue: Callus, score: 78.72 N N N N
vg1103515499 A -> G LOC_Os11g07060.4 upstream_gene_variant ; 2293.0bp to feature; MODIFIER silent_mutation Average:30.526; most accessible tissue: Callus, score: 78.72 N N N N
vg1103515499 A -> G LOC_Os11g07060.5 upstream_gene_variant ; 2293.0bp to feature; MODIFIER silent_mutation Average:30.526; most accessible tissue: Callus, score: 78.72 N N N N
vg1103515499 A -> G LOC_Os11g07050-LOC_Os11g07060 intergenic_region ; MODIFIER silent_mutation Average:30.526; most accessible tissue: Callus, score: 78.72 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1103515499 NA 1.11E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499 5.20E-08 NA mr1107 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499 NA 4.19E-06 mr1107 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499 2.48E-07 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499 NA 5.09E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499 NA 9.89E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499 NA 5.23E-12 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499 NA 9.48E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499 5.01E-07 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499 2.78E-09 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499 NA 1.05E-06 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499 3.99E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499 NA 2.64E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515499 NA 1.63E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251