\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103515104:

Variant ID: vg1103515104 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 3515104
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCTGAGATACCGGGGTTGGCCTGTGATGATTTAATTTGTTGAGGGCCTATATGCATTCTTTGCCATGACAATTAACGATTTGTTTAGGGCTCCCTATGA[G/A]
TTTGAGAAAGAAATGACTGTTGATGGAAATTAAGGCCGGTGAAACTTCTTCTGTCTGCTCTGTGCGACAGACATAAAAAAAATGCATGAGATACTTTGTT

Reverse complement sequence

AACAAAGTATCTCATGCATTTTTTTTATGTCTGTCGCACAGAGCAGACAGAAGAAGTTTCACCGGCCTTAATTTCCATCAACAGTCATTTCTTTCTCAAA[C/T]
TCATAGGGAGCCCTAAACAAATCGTTAATTGTCATGGCAAAGAATGCATATAGGCCCTCAACAAATTAAATCATCACAGGCCAACCCCGGTATCTCAGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.50% 11.90% 1.25% 24.31% NA
All Indica  2759 59.20% 0.90% 1.67% 38.27% NA
All Japonica  1512 62.00% 34.50% 0.73% 2.84% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 50.60% 0.30% 0.84% 48.24% NA
Indica II  465 80.00% 0.40% 2.15% 17.42% NA
Indica III  913 58.50% 0.20% 1.31% 39.98% NA
Indica Intermediate  786 54.20% 2.30% 2.42% 41.09% NA
Temperate Japonica  767 80.70% 18.30% 0.91% 0.13% NA
Tropical Japonica  504 28.60% 63.70% 0.00% 7.74% NA
Japonica Intermediate  241 72.20% 24.90% 1.66% 1.24% NA
VI/Aromatic  96 59.40% 1.00% 2.08% 37.50% NA
Intermediate  90 66.70% 17.80% 0.00% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1103515104 G -> A LOC_Os11g07050.1 upstream_gene_variant ; 2324.0bp to feature; MODIFIER silent_mutation Average:36.267; most accessible tissue: Callus, score: 81.374 N N N N
vg1103515104 G -> A LOC_Os11g07060.1 upstream_gene_variant ; 2688.0bp to feature; MODIFIER silent_mutation Average:36.267; most accessible tissue: Callus, score: 81.374 N N N N
vg1103515104 G -> A LOC_Os11g07060.2 upstream_gene_variant ; 1909.0bp to feature; MODIFIER silent_mutation Average:36.267; most accessible tissue: Callus, score: 81.374 N N N N
vg1103515104 G -> A LOC_Os11g07060.3 upstream_gene_variant ; 2688.0bp to feature; MODIFIER silent_mutation Average:36.267; most accessible tissue: Callus, score: 81.374 N N N N
vg1103515104 G -> A LOC_Os11g07060.4 upstream_gene_variant ; 2688.0bp to feature; MODIFIER silent_mutation Average:36.267; most accessible tissue: Callus, score: 81.374 N N N N
vg1103515104 G -> A LOC_Os11g07060.5 upstream_gene_variant ; 2688.0bp to feature; MODIFIER silent_mutation Average:36.267; most accessible tissue: Callus, score: 81.374 N N N N
vg1103515104 G -> A LOC_Os11g07050-LOC_Os11g07060 intergenic_region ; MODIFIER silent_mutation Average:36.267; most accessible tissue: Callus, score: 81.374 N N N N
vg1103515104 G -> DEL N N silent_mutation Average:36.267; most accessible tissue: Callus, score: 81.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1103515104 NA 9.34E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 NA 1.47E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 4.03E-06 NA mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 NA 9.03E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 4.64E-06 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 2.29E-08 NA mr1226 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 4.46E-06 2.37E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 NA 3.88E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 5.46E-06 1.95E-12 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 NA 5.98E-06 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 9.46E-06 NA mr1070_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 NA 1.15E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 5.19E-06 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 NA 1.42E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 1.59E-06 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 7.27E-08 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 2.95E-11 NA mr1107_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 9.83E-07 1.84E-07 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 8.92E-08 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 NA 6.44E-07 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 NA 4.70E-07 mr1227_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 5.71E-06 NA mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 NA 1.15E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 6.13E-06 NA mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104 NA 8.39E-06 mr1949_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251