Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103515104:

Variant ID: vg1103515104 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 3515104
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCTGAGATACCGGGGTTGGCCTGTGATGATTTAATTTGTTGAGGGCCTATATGCATTCTTTGCCATGACAATTAACGATTTGTTTAGGGCTCCCTATGA[G/A]
TTTGAGAAAGAAATGACTGTTGATGGAAATTAAGGCCGGTGAAACTTCTTCTGTCTGCTCTGTGCGACAGACATAAAAAAAATGCATGAGATACTTTGTT

Reverse complement sequence

AACAAAGTATCTCATGCATTTTTTTTATGTCTGTCGCACAGAGCAGACAGAAGAAGTTTCACCGGCCTTAATTTCCATCAACAGTCATTTCTTTCTCAAA[C/T]
TCATAGGGAGCCCTAAACAAATCGTTAATTGTCATGGCAAAGAATGCATATAGGCCCTCAACAAATTAAATCATCACAGGCCAACCCCGGTATCTCAGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.50%	11.90%	1.25%	24.31%	NA
All Indica	2759	59.20%	0.90%	1.67%	38.27%	NA
All Japonica	1512	62.00%	34.50%	0.73%	2.84%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	50.60%	0.30%	0.84%	48.24%	NA
Indica II	465	80.00%	0.40%	2.15%	17.42%	NA
Indica III	913	58.50%	0.20%	1.31%	39.98%	NA
Indica Intermediate	786	54.20%	2.30%	2.42%	41.09%	NA
Temperate Japonica	767	80.70%	18.30%	0.91%	0.13%	NA
Tropical Japonica	504	28.60%	63.70%	0.00%	7.74%	NA
Japonica Intermediate	241	72.20%	24.90%	1.66%	1.24%	NA
VI/Aromatic	96	59.40%	1.00%	2.08%	37.50%	NA
Intermediate	90	66.70%	17.80%	0.00%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1103515104	G -> A	LOC_Os11g07050.1	upstream_gene_variant ; 2324.0bp to feature; MODIFIER	silent_mutation	Average:36.267; most accessible tissue: Callus, score: 81.374	N	N	N	N
vg1103515104	G -> A	LOC_Os11g07060.1	upstream_gene_variant ; 2688.0bp to feature; MODIFIER	silent_mutation	Average:36.267; most accessible tissue: Callus, score: 81.374	N	N	N	N
vg1103515104	G -> A	LOC_Os11g07060.2	upstream_gene_variant ; 1909.0bp to feature; MODIFIER	silent_mutation	Average:36.267; most accessible tissue: Callus, score: 81.374	N	N	N	N
vg1103515104	G -> A	LOC_Os11g07060.3	upstream_gene_variant ; 2688.0bp to feature; MODIFIER	silent_mutation	Average:36.267; most accessible tissue: Callus, score: 81.374	N	N	N	N
vg1103515104	G -> A	LOC_Os11g07060.4	upstream_gene_variant ; 2688.0bp to feature; MODIFIER	silent_mutation	Average:36.267; most accessible tissue: Callus, score: 81.374	N	N	N	N
vg1103515104	G -> A	LOC_Os11g07060.5	upstream_gene_variant ; 2688.0bp to feature; MODIFIER	silent_mutation	Average:36.267; most accessible tissue: Callus, score: 81.374	N	N	N	N
vg1103515104	G -> A	LOC_Os11g07050-LOC_Os11g07060	intergenic_region ; MODIFIER	silent_mutation	Average:36.267; most accessible tissue: Callus, score: 81.374	N	N	N	N
vg1103515104	G -> DEL	N	N	silent_mutation	Average:36.267; most accessible tissue: Callus, score: 81.374	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1103515104	NA	9.34E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	NA	1.47E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	4.03E-06	NA	mr1086	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	NA	9.03E-06	mr1086	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	4.64E-06	NA	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	2.29E-08	NA	mr1226	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	4.46E-06	2.37E-07	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	NA	3.88E-07	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	5.46E-06	1.95E-12	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	NA	5.98E-06	mr1949	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	9.46E-06	NA	mr1070_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	NA	1.15E-06	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	5.19E-06	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	NA	1.42E-06	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	1.59E-06	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	7.27E-08	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	2.95E-11	NA	mr1107_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	9.83E-07	1.84E-07	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	8.92E-08	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	NA	6.44E-07	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	NA	4.70E-07	mr1227_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	5.71E-06	NA	mr1233_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	NA	1.15E-08	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	6.13E-06	NA	mr1949_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103515104	NA	8.39E-06	mr1949_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251