\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103514429:

Variant ID: vg1103514429 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 3514429
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACACAGCTCAAGCGGGACGGGGAGAGTGACCAGGAGACAGTGTGCCGCCGCGCCCCTTCCCTGCCAGCTCCTCGGCGGCGCAAGCAAGGAGTCCATGGT[C/A]
GAGCGCGCTGGCCCGCCAGCCGAGCAAAGGAGAACCAATCTGCGGACGACATCAGTTGGATAAGCATAGTATCATACATACACCAATATACAGGCTTGCT

Reverse complement sequence

AGCAAGCCTGTATATTGGTGTATGTATGATACTATGCTTATCCAACTGATGTCGTCCGCAGATTGGTTCTCCTTTGCTCGGCTGGCGGGCCAGCGCGCTC[G/T]
ACCATGGACTCCTTGCTTGCGCCGCCGAGGAGCTGGCAGGGAAGGGGCGCGGCGGCACACTGTCTCCTGGTCACTCTCCCCGTCCCGCTTGAGCTGTGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.10% 11.80% 1.44% 23.66% NA
All Indica  2759 59.80% 0.90% 2.07% 37.19% NA
All Japonica  1512 62.80% 33.70% 0.73% 2.78% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 51.10% 0.30% 1.34% 47.23% NA
Indica II  465 80.40% 0.40% 1.72% 17.42% NA
Indica III  913 58.60% 0.20% 1.97% 39.21% NA
Indica Intermediate  786 55.70% 2.40% 2.93% 38.93% NA
Temperate Japonica  767 81.10% 17.70% 1.04% 0.13% NA
Tropical Japonica  504 29.00% 63.30% 0.20% 7.54% NA
Japonica Intermediate  241 75.10% 22.80% 0.83% 1.24% NA
VI/Aromatic  96 61.50% 1.00% 0.00% 37.50% NA
Intermediate  90 66.70% 17.80% 0.00% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1103514429 C -> A LOC_Os11g07050.1 upstream_gene_variant ; 1649.0bp to feature; MODIFIER silent_mutation Average:51.044; most accessible tissue: Callus, score: 95.806 N N N N
vg1103514429 C -> A LOC_Os11g07060.1 upstream_gene_variant ; 3363.0bp to feature; MODIFIER silent_mutation Average:51.044; most accessible tissue: Callus, score: 95.806 N N N N
vg1103514429 C -> A LOC_Os11g07060.2 upstream_gene_variant ; 2584.0bp to feature; MODIFIER silent_mutation Average:51.044; most accessible tissue: Callus, score: 95.806 N N N N
vg1103514429 C -> A LOC_Os11g07060.3 upstream_gene_variant ; 3363.0bp to feature; MODIFIER silent_mutation Average:51.044; most accessible tissue: Callus, score: 95.806 N N N N
vg1103514429 C -> A LOC_Os11g07060.4 upstream_gene_variant ; 3363.0bp to feature; MODIFIER silent_mutation Average:51.044; most accessible tissue: Callus, score: 95.806 N N N N
vg1103514429 C -> A LOC_Os11g07060.5 upstream_gene_variant ; 3363.0bp to feature; MODIFIER silent_mutation Average:51.044; most accessible tissue: Callus, score: 95.806 N N N N
vg1103514429 C -> A LOC_Os11g07050-LOC_Os11g07060 intergenic_region ; MODIFIER silent_mutation Average:51.044; most accessible tissue: Callus, score: 95.806 N N N N
vg1103514429 C -> DEL N N silent_mutation Average:51.044; most accessible tissue: Callus, score: 95.806 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1103514429 C A 0.02 0.03 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1103514429 NA 5.37E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 9.87E-07 NA mr1086 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 NA 1.99E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 2.48E-06 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 4.52E-07 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 NA 8.42E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 NA 3.31E-06 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 2.00E-07 8.15E-13 mr1949 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 NA 6.45E-07 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 2.24E-06 NA mr1070_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 NA 5.50E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 NA 6.24E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 2.32E-06 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 9.09E-08 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 8.80E-11 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 1.95E-07 2.34E-07 mr1107_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 3.76E-07 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 NA 2.18E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 NA 4.07E-06 mr1227_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 3.08E-06 NA mr1233_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 NA 9.24E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 9.81E-06 NA mr1437_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 1.18E-06 NA mr1949_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429 9.57E-06 6.67E-06 mr1949_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251