Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103514429:

Variant ID: vg1103514429 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 3514429
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACACAGCTCAAGCGGGACGGGGAGAGTGACCAGGAGACAGTGTGCCGCCGCGCCCCTTCCCTGCCAGCTCCTCGGCGGCGCAAGCAAGGAGTCCATGGT[C/A]
GAGCGCGCTGGCCCGCCAGCCGAGCAAAGGAGAACCAATCTGCGGACGACATCAGTTGGATAAGCATAGTATCATACATACACCAATATACAGGCTTGCT

Reverse complement sequence

AGCAAGCCTGTATATTGGTGTATGTATGATACTATGCTTATCCAACTGATGTCGTCCGCAGATTGGTTCTCCTTTGCTCGGCTGGCGGGCCAGCGCGCTC[G/T]
ACCATGGACTCCTTGCTTGCGCCGCCGAGGAGCTGGCAGGGAAGGGGCGCGGCGGCACACTGTCTCCTGGTCACTCTCCCCGTCCCGCTTGAGCTGTGTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.10%	11.80%	1.44%	23.66%	NA
All Indica	2759	59.80%	0.90%	2.07%	37.19%	NA
All Japonica	1512	62.80%	33.70%	0.73%	2.78%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	51.10%	0.30%	1.34%	47.23%	NA
Indica II	465	80.40%	0.40%	1.72%	17.42%	NA
Indica III	913	58.60%	0.20%	1.97%	39.21%	NA
Indica Intermediate	786	55.70%	2.40%	2.93%	38.93%	NA
Temperate Japonica	767	81.10%	17.70%	1.04%	0.13%	NA
Tropical Japonica	504	29.00%	63.30%	0.20%	7.54%	NA
Japonica Intermediate	241	75.10%	22.80%	0.83%	1.24%	NA
VI/Aromatic	96	61.50%	1.00%	0.00%	37.50%	NA
Intermediate	90	66.70%	17.80%	0.00%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1103514429	C -> A	LOC_Os11g07050.1	upstream_gene_variant ; 1649.0bp to feature; MODIFIER	silent_mutation	Average:51.044; most accessible tissue: Callus, score: 95.806	N	N	N	N
vg1103514429	C -> A	LOC_Os11g07060.1	upstream_gene_variant ; 3363.0bp to feature; MODIFIER	silent_mutation	Average:51.044; most accessible tissue: Callus, score: 95.806	N	N	N	N
vg1103514429	C -> A	LOC_Os11g07060.2	upstream_gene_variant ; 2584.0bp to feature; MODIFIER	silent_mutation	Average:51.044; most accessible tissue: Callus, score: 95.806	N	N	N	N
vg1103514429	C -> A	LOC_Os11g07060.3	upstream_gene_variant ; 3363.0bp to feature; MODIFIER	silent_mutation	Average:51.044; most accessible tissue: Callus, score: 95.806	N	N	N	N
vg1103514429	C -> A	LOC_Os11g07060.4	upstream_gene_variant ; 3363.0bp to feature; MODIFIER	silent_mutation	Average:51.044; most accessible tissue: Callus, score: 95.806	N	N	N	N
vg1103514429	C -> A	LOC_Os11g07060.5	upstream_gene_variant ; 3363.0bp to feature; MODIFIER	silent_mutation	Average:51.044; most accessible tissue: Callus, score: 95.806	N	N	N	N
vg1103514429	C -> A	LOC_Os11g07050-LOC_Os11g07060	intergenic_region ; MODIFIER	silent_mutation	Average:51.044; most accessible tissue: Callus, score: 95.806	N	N	N	N
vg1103514429	C -> DEL	N	N	silent_mutation	Average:51.044; most accessible tissue: Callus, score: 95.806	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1103514429	C	A	0.02	0.03	0.01	0.01	0.01	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1103514429	NA	5.37E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	9.87E-07	NA	mr1086	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	NA	1.99E-06	mr1086	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	2.48E-06	NA	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	4.52E-07	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	NA	8.42E-07	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	NA	3.31E-06	mr1852	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	2.00E-07	8.15E-13	mr1949	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	NA	6.45E-07	mr1949	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	2.24E-06	NA	mr1070_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	NA	5.50E-06	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	NA	6.24E-06	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	2.32E-06	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	9.09E-08	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	8.80E-11	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	1.95E-07	2.34E-07	mr1107_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	3.76E-07	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	NA	2.18E-06	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	NA	4.07E-06	mr1227_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	3.08E-06	NA	mr1233_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	NA	9.24E-08	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	9.81E-06	NA	mr1437_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	1.18E-06	NA	mr1949_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103514429	9.57E-06	6.67E-06	mr1949_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251