\
| Variant ID: vg1103485731 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 3485731 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 113. )
CTGGCCTCCAACATCTTGCAGCCTCTCTTCATCAAATATAAAAAAAAGAGAAAATTCCCTATATACCCCTGAAAATTTACTCAATCCCTTCAATACCCCT[G/A]
AATTTGACATTATCCCTTATATACCCCTGAGTTTTCATTTTGATCTCCTCTATACCCATCTCCGTTAGTTGACCATTAGTTGACCGTTAAATATTTTAAA
TTTAAAATATTTAACGGTCAACTAATGGTCAACTAACGGAGATGGGTATAGAGGAGATCAAAATGAAAACTCAGGGGTATATAAGGGATAATGTCAAATT[C/T]
AGGGGTATTGAAGGGATTGAGTAAATTTTCAGGGGTATATAGGGAATTTTCTCTTTTTTTTATATTTGATGAAGAGAGGCTGCAAGATGTTGGAGGCCAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 22.60% | 7.30% | 1.54% | 68.58% | NA |
| All Indica | 2759 | 0.60% | 0.80% | 0.76% | 97.83% | NA |
| All Japonica | 1512 | 64.50% | 20.60% | 3.04% | 11.84% | NA |
| Aus | 269 | 3.00% | 0.00% | 0.00% | 97.03% | NA |
| Indica I | 595 | 0.50% | 0.20% | 1.34% | 97.98% | NA |
| Indica II | 465 | 0.60% | 0.40% | 0.22% | 98.71% | NA |
| Indica III | 913 | 0.20% | 0.20% | 0.44% | 99.12% | NA |
| Indica Intermediate | 786 | 1.00% | 2.30% | 1.02% | 95.67% | NA |
| Temperate Japonica | 767 | 92.40% | 1.20% | 3.65% | 2.74% | NA |
| Tropical Japonica | 504 | 14.70% | 55.20% | 2.58% | 27.58% | NA |
| Japonica Intermediate | 241 | 79.70% | 10.40% | 2.07% | 7.88% | NA |
| VI/Aromatic | 96 | 49.00% | 0.00% | 0.00% | 51.04% | NA |
| Intermediate | 90 | 22.20% | 12.20% | 6.67% | 58.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1103485731 | G -> A | LOC_Os11g07000.1 | downstream_gene_variant ; 1865.0bp to feature; MODIFIER | silent_mutation | Average:41.923; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| vg1103485731 | G -> A | LOC_Os11g07010.1 | downstream_gene_variant ; 489.0bp to feature; MODIFIER | silent_mutation | Average:41.923; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| vg1103485731 | G -> A | LOC_Os11g07020.1 | downstream_gene_variant ; 2822.0bp to feature; MODIFIER | silent_mutation | Average:41.923; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| vg1103485731 | G -> A | LOC_Os11g07020.4 | downstream_gene_variant ; 2822.0bp to feature; MODIFIER | silent_mutation | Average:41.923; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| vg1103485731 | G -> A | LOC_Os11g07020.5 | downstream_gene_variant ; 2822.0bp to feature; MODIFIER | silent_mutation | Average:41.923; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| vg1103485731 | G -> A | LOC_Os11g07020.6 | downstream_gene_variant ; 2822.0bp to feature; MODIFIER | silent_mutation | Average:41.923; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| vg1103485731 | G -> A | LOC_Os11g07020.7 | downstream_gene_variant ; 2822.0bp to feature; MODIFIER | silent_mutation | Average:41.923; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| vg1103485731 | G -> A | LOC_Os11g07010-LOC_Os11g07020 | intergenic_region ; MODIFIER | silent_mutation | Average:41.923; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| vg1103485731 | G -> DEL | N | N | silent_mutation | Average:41.923; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1103485731 | NA | 2.43E-09 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103485731 | NA | 6.73E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103485731 | NA | 1.33E-09 | mr1543 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103485731 | NA | 4.14E-08 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103485731 | NA | 1.27E-06 | mr1742 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103485731 | NA | 4.30E-06 | mr1808 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103485731 | NA | 2.49E-07 | mr1892 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103485731 | NA | 3.83E-09 | mr1543_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103485731 | NA | 1.71E-09 | mr1642_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |