\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103485731:

Variant ID: vg1103485731 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 3485731
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


CTGGCCTCCAACATCTTGCAGCCTCTCTTCATCAAATATAAAAAAAAGAGAAAATTCCCTATATACCCCTGAAAATTTACTCAATCCCTTCAATACCCCT[G/A]
AATTTGACATTATCCCTTATATACCCCTGAGTTTTCATTTTGATCTCCTCTATACCCATCTCCGTTAGTTGACCATTAGTTGACCGTTAAATATTTTAAA

Reverse complement sequence

TTTAAAATATTTAACGGTCAACTAATGGTCAACTAACGGAGATGGGTATAGAGGAGATCAAAATGAAAACTCAGGGGTATATAAGGGATAATGTCAAATT[C/T]
AGGGGTATTGAAGGGATTGAGTAAATTTTCAGGGGTATATAGGGAATTTTCTCTTTTTTTTATATTTGATGAAGAGAGGCTGCAAGATGTTGGAGGCCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.60% 7.30% 1.54% 68.58% NA
All Indica  2759 0.60% 0.80% 0.76% 97.83% NA
All Japonica  1512 64.50% 20.60% 3.04% 11.84% NA
Aus  269 3.00% 0.00% 0.00% 97.03% NA
Indica I  595 0.50% 0.20% 1.34% 97.98% NA
Indica II  465 0.60% 0.40% 0.22% 98.71% NA
Indica III  913 0.20% 0.20% 0.44% 99.12% NA
Indica Intermediate  786 1.00% 2.30% 1.02% 95.67% NA
Temperate Japonica  767 92.40% 1.20% 3.65% 2.74% NA
Tropical Japonica  504 14.70% 55.20% 2.58% 27.58% NA
Japonica Intermediate  241 79.70% 10.40% 2.07% 7.88% NA
VI/Aromatic  96 49.00% 0.00% 0.00% 51.04% NA
Intermediate  90 22.20% 12.20% 6.67% 58.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1103485731 G -> A LOC_Os11g07000.1 downstream_gene_variant ; 1865.0bp to feature; MODIFIER silent_mutation Average:41.923; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N
vg1103485731 G -> A LOC_Os11g07010.1 downstream_gene_variant ; 489.0bp to feature; MODIFIER silent_mutation Average:41.923; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N
vg1103485731 G -> A LOC_Os11g07020.1 downstream_gene_variant ; 2822.0bp to feature; MODIFIER silent_mutation Average:41.923; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N
vg1103485731 G -> A LOC_Os11g07020.4 downstream_gene_variant ; 2822.0bp to feature; MODIFIER silent_mutation Average:41.923; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N
vg1103485731 G -> A LOC_Os11g07020.5 downstream_gene_variant ; 2822.0bp to feature; MODIFIER silent_mutation Average:41.923; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N
vg1103485731 G -> A LOC_Os11g07020.6 downstream_gene_variant ; 2822.0bp to feature; MODIFIER silent_mutation Average:41.923; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N
vg1103485731 G -> A LOC_Os11g07020.7 downstream_gene_variant ; 2822.0bp to feature; MODIFIER silent_mutation Average:41.923; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N
vg1103485731 G -> A LOC_Os11g07010-LOC_Os11g07020 intergenic_region ; MODIFIER silent_mutation Average:41.923; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N
vg1103485731 G -> DEL N N silent_mutation Average:41.923; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1103485731 NA 2.43E-09 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103485731 NA 6.73E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103485731 NA 1.33E-09 mr1543 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103485731 NA 4.14E-08 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103485731 NA 1.27E-06 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103485731 NA 4.30E-06 mr1808 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103485731 NA 2.49E-07 mr1892 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103485731 NA 3.83E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103485731 NA 1.71E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251