Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103424320:

Variant ID: vg1103424320 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 3424320
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTTAACTCCTCCAAGACAGTTAAGTACAAATTGCGGAGATTCGCACCCGATCGGAAACAGGCCATACGAGAAGAACTCGACAAACTTCTCAAAGCTGG[T/C]
TTCATCAGAGAAGTCATCAATCCAGAGTGGCTCACCACTCCAGTAATGGTACGCAAAGCCAACAGAAAGTGGAAGTTGTGTGTCAACTTCACCGACCTCA

Reverse complement sequence

TGAGGTCGGTGAAGTTGACACACAACTTCCACTTTCTGTTGGCTTTGCGTACCATTACTGGAGTGGTGAGCCACTCTGGATTGATGACTTCTCTGATGAA[A/G]
CCAGCTTTGAGAAGTTTGTCGAGTTCTTCTCGTATGGCCTGTTTCCGATCGGGTGCGAATCTCCGCAATTTGTACTTAACTGTCTTGGAGGAGTTAAATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.10%	6.40%	15.28%	47.25%	NA
All Indica	2759	3.20%	7.10%	18.81%	70.82%	NA
All Japonica	1512	80.20%	5.30%	4.96%	9.59%	NA
Aus	269	31.60%	4.80%	31.97%	31.60%	NA
Indica I	595	3.40%	12.10%	18.66%	65.88%	NA
Indica II	465	1.50%	6.20%	12.04%	80.22%	NA
Indica III	913	1.60%	5.70%	23.11%	69.55%	NA
Indica Intermediate	786	6.00%	5.60%	17.94%	70.48%	NA
Temperate Japonica	767	87.50%	0.30%	2.22%	10.04%	NA
Tropical Japonica	504	67.70%	14.10%	9.92%	8.33%	NA
Japonica Intermediate	241	83.00%	2.90%	3.32%	10.79%	NA
VI/Aromatic	96	47.90%	5.20%	31.25%	15.62%	NA
Intermediate	90	41.10%	7.80%	13.33%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1103424320	T -> DEL	N	N	silent_mutation	Average:16.659; most accessible tissue: Callus, score: 96.711	N	N	N	N
vg1103424320	T -> C	LOC_Os11g06930.1	upstream_gene_variant ; 310.0bp to feature; MODIFIER	silent_mutation	Average:16.659; most accessible tissue: Callus, score: 96.711	N	N	N	N
vg1103424320	T -> C	LOC_Os11g06934.1	upstream_gene_variant ; 1502.0bp to feature; MODIFIER	silent_mutation	Average:16.659; most accessible tissue: Callus, score: 96.711	N	N	N	N
vg1103424320	T -> C	LOC_Os11g06934.2	upstream_gene_variant ; 1513.0bp to feature; MODIFIER	silent_mutation	Average:16.659; most accessible tissue: Callus, score: 96.711	N	N	N	N
vg1103424320	T -> C	LOC_Os11g06930-LOC_Os11g06934	intergenic_region ; MODIFIER	silent_mutation	Average:16.659; most accessible tissue: Callus, score: 96.711	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1103424320	NA	4.80E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103424320	NA	6.86E-06	mr1791	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103424320	NA	5.48E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103424320	NA	5.44E-06	mr1304_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103424320	NA	5.27E-08	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103424320	NA	1.34E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103424320	3.98E-06	6.93E-07	mr1790_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103424320	NA	1.24E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251