\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103424320:

Variant ID: vg1103424320 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 3424320
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTTAACTCCTCCAAGACAGTTAAGTACAAATTGCGGAGATTCGCACCCGATCGGAAACAGGCCATACGAGAAGAACTCGACAAACTTCTCAAAGCTGG[T/C]
TTCATCAGAGAAGTCATCAATCCAGAGTGGCTCACCACTCCAGTAATGGTACGCAAAGCCAACAGAAAGTGGAAGTTGTGTGTCAACTTCACCGACCTCA

Reverse complement sequence

TGAGGTCGGTGAAGTTGACACACAACTTCCACTTTCTGTTGGCTTTGCGTACCATTACTGGAGTGGTGAGCCACTCTGGATTGATGACTTCTCTGATGAA[A/G]
CCAGCTTTGAGAAGTTTGTCGAGTTCTTCTCGTATGGCCTGTTTCCGATCGGGTGCGAATCTCCGCAATTTGTACTTAACTGTCTTGGAGGAGTTAAATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.10% 6.40% 15.28% 47.25% NA
All Indica  2759 3.20% 7.10% 18.81% 70.82% NA
All Japonica  1512 80.20% 5.30% 4.96% 9.59% NA
Aus  269 31.60% 4.80% 31.97% 31.60% NA
Indica I  595 3.40% 12.10% 18.66% 65.88% NA
Indica II  465 1.50% 6.20% 12.04% 80.22% NA
Indica III  913 1.60% 5.70% 23.11% 69.55% NA
Indica Intermediate  786 6.00% 5.60% 17.94% 70.48% NA
Temperate Japonica  767 87.50% 0.30% 2.22% 10.04% NA
Tropical Japonica  504 67.70% 14.10% 9.92% 8.33% NA
Japonica Intermediate  241 83.00% 2.90% 3.32% 10.79% NA
VI/Aromatic  96 47.90% 5.20% 31.25% 15.62% NA
Intermediate  90 41.10% 7.80% 13.33% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1103424320 T -> DEL N N silent_mutation Average:16.659; most accessible tissue: Callus, score: 96.711 N N N N
vg1103424320 T -> C LOC_Os11g06930.1 upstream_gene_variant ; 310.0bp to feature; MODIFIER silent_mutation Average:16.659; most accessible tissue: Callus, score: 96.711 N N N N
vg1103424320 T -> C LOC_Os11g06934.1 upstream_gene_variant ; 1502.0bp to feature; MODIFIER silent_mutation Average:16.659; most accessible tissue: Callus, score: 96.711 N N N N
vg1103424320 T -> C LOC_Os11g06934.2 upstream_gene_variant ; 1513.0bp to feature; MODIFIER silent_mutation Average:16.659; most accessible tissue: Callus, score: 96.711 N N N N
vg1103424320 T -> C LOC_Os11g06930-LOC_Os11g06934 intergenic_region ; MODIFIER silent_mutation Average:16.659; most accessible tissue: Callus, score: 96.711 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1103424320 NA 4.80E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103424320 NA 6.86E-06 mr1791 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103424320 NA 5.48E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103424320 NA 5.44E-06 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103424320 NA 5.27E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103424320 NA 1.34E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103424320 3.98E-06 6.93E-07 mr1790_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103424320 NA 1.24E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251