\
| Variant ID: vg1103424320 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 3424320 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AATTTAACTCCTCCAAGACAGTTAAGTACAAATTGCGGAGATTCGCACCCGATCGGAAACAGGCCATACGAGAAGAACTCGACAAACTTCTCAAAGCTGG[T/C]
TTCATCAGAGAAGTCATCAATCCAGAGTGGCTCACCACTCCAGTAATGGTACGCAAAGCCAACAGAAAGTGGAAGTTGTGTGTCAACTTCACCGACCTCA
TGAGGTCGGTGAAGTTGACACACAACTTCCACTTTCTGTTGGCTTTGCGTACCATTACTGGAGTGGTGAGCCACTCTGGATTGATGACTTCTCTGATGAA[A/G]
CCAGCTTTGAGAAGTTTGTCGAGTTCTTCTCGTATGGCCTGTTTCCGATCGGGTGCGAATCTCCGCAATTTGTACTTAACTGTCTTGGAGGAGTTAAATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.10% | 6.40% | 15.28% | 47.25% | NA |
| All Indica | 2759 | 3.20% | 7.10% | 18.81% | 70.82% | NA |
| All Japonica | 1512 | 80.20% | 5.30% | 4.96% | 9.59% | NA |
| Aus | 269 | 31.60% | 4.80% | 31.97% | 31.60% | NA |
| Indica I | 595 | 3.40% | 12.10% | 18.66% | 65.88% | NA |
| Indica II | 465 | 1.50% | 6.20% | 12.04% | 80.22% | NA |
| Indica III | 913 | 1.60% | 5.70% | 23.11% | 69.55% | NA |
| Indica Intermediate | 786 | 6.00% | 5.60% | 17.94% | 70.48% | NA |
| Temperate Japonica | 767 | 87.50% | 0.30% | 2.22% | 10.04% | NA |
| Tropical Japonica | 504 | 67.70% | 14.10% | 9.92% | 8.33% | NA |
| Japonica Intermediate | 241 | 83.00% | 2.90% | 3.32% | 10.79% | NA |
| VI/Aromatic | 96 | 47.90% | 5.20% | 31.25% | 15.62% | NA |
| Intermediate | 90 | 41.10% | 7.80% | 13.33% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1103424320 | T -> DEL | N | N | silent_mutation | Average:16.659; most accessible tissue: Callus, score: 96.711 | N | N | N | N |
| vg1103424320 | T -> C | LOC_Os11g06930.1 | upstream_gene_variant ; 310.0bp to feature; MODIFIER | silent_mutation | Average:16.659; most accessible tissue: Callus, score: 96.711 | N | N | N | N |
| vg1103424320 | T -> C | LOC_Os11g06934.1 | upstream_gene_variant ; 1502.0bp to feature; MODIFIER | silent_mutation | Average:16.659; most accessible tissue: Callus, score: 96.711 | N | N | N | N |
| vg1103424320 | T -> C | LOC_Os11g06934.2 | upstream_gene_variant ; 1513.0bp to feature; MODIFIER | silent_mutation | Average:16.659; most accessible tissue: Callus, score: 96.711 | N | N | N | N |
| vg1103424320 | T -> C | LOC_Os11g06930-LOC_Os11g06934 | intergenic_region ; MODIFIER | silent_mutation | Average:16.659; most accessible tissue: Callus, score: 96.711 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1103424320 | NA | 4.80E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103424320 | NA | 6.86E-06 | mr1791 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103424320 | NA | 5.48E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103424320 | NA | 5.44E-06 | mr1304_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103424320 | NA | 5.27E-08 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103424320 | NA | 1.34E-08 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103424320 | 3.98E-06 | 6.93E-07 | mr1790_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103424320 | NA | 1.24E-07 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |