| Variant ID: vg1103330790 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 3330790 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 93. )
AAGAAAGTTTTCAAAGATAAATAGGCTTAGGAAAGTGAGTGCTGGCTAGTTGGGATGAGAAAATTTTCATTATTACTCTTGATGATGAGCACTATAATGG[T/C]
TATATTGAGGTATATGTCTTACCTTGTGGGTTCTTTGTTTTATTTTTATAACTTTTTATTGCATTTTCTTATACAATAACTTTTGTTTCATGAAGGATCA
TGATCCTTCATGAAACAAAAGTTATTGTATAAGAAAATGCAATAAAAAGTTATAAAAATAAAACAAAGAACCCACAAGGTAAGACATATACCTCAATATA[A/G]
CCATTATAGTGCTCATCATCAAGAGTAATAATGAAAATTTTCTCATCCCAACTAGCCAGCACTCACTTTCCTAAGCCTATTTATCTTTGAAAACTTTCTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.30% | 4.70% | 13.97% | 46.00% | NA |
| All Indica | 2759 | 6.90% | 7.90% | 21.17% | 64.08% | NA |
| All Japonica | 1512 | 89.00% | 0.10% | 2.91% | 8.00% | NA |
| Aus | 269 | 4.50% | 0.00% | 7.81% | 87.73% | NA |
| Indica I | 595 | 6.60% | 1.80% | 9.75% | 81.85% | NA |
| Indica II | 465 | 3.40% | 16.10% | 26.02% | 54.41% | NA |
| Indica III | 913 | 7.70% | 7.90% | 24.86% | 59.58% | NA |
| Indica Intermediate | 786 | 8.30% | 7.50% | 22.65% | 61.58% | NA |
| Temperate Japonica | 767 | 97.10% | 0.00% | 0.39% | 2.48% | NA |
| Tropical Japonica | 504 | 74.80% | 0.20% | 7.34% | 17.66% | NA |
| Japonica Intermediate | 241 | 92.90% | 0.00% | 1.66% | 5.39% | NA |
| VI/Aromatic | 96 | 85.40% | 0.00% | 3.12% | 11.46% | NA |
| Intermediate | 90 | 43.30% | 5.60% | 8.89% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1103330790 | T -> DEL | N | N | silent_mutation | Average:15.645; most accessible tissue: Callus, score: 54.42 | N | N | N | N |
| vg1103330790 | T -> C | LOC_Os11g06810.1 | upstream_gene_variant ; 1656.0bp to feature; MODIFIER | silent_mutation | Average:15.645; most accessible tissue: Callus, score: 54.42 | N | N | N | N |
| vg1103330790 | T -> C | LOC_Os11g06790.1 | downstream_gene_variant ; 2480.0bp to feature; MODIFIER | silent_mutation | Average:15.645; most accessible tissue: Callus, score: 54.42 | N | N | N | N |
| vg1103330790 | T -> C | LOC_Os11g06800.1 | intron_variant ; MODIFIER | silent_mutation | Average:15.645; most accessible tissue: Callus, score: 54.42 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1103330790 | NA | 1.96E-07 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103330790 | NA | 3.21E-07 | mr1040 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103330790 | NA | 3.20E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103330790 | NA | 1.26E-12 | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103330790 | NA | 1.78E-06 | mr1401 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103330790 | NA | 3.24E-08 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103330790 | 1.99E-07 | 6.33E-08 | mr1804 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103330790 | NA | 4.82E-06 | mr1857 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103330790 | NA | 8.63E-06 | mr1965 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |