\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103306604:

Variant ID: vg1103306604 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 3306604
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


GGCGTTCGTCACGACTCCAAATGCGAACTTGACCGTCTTGCTCTTAACATCGTCGTTGCTTACGATACTACGGCCGAAAACTCGTTCACCTTCGTCTGTC[G/A]
GTGTCAGACGGCAAACGGGTTCATACACCAGATGCATAGCCTTTCTCACCGAAATACTCCAATTTAGTTGTAATATAAATTTTATAGAGTTGTAATAATA

Reverse complement sequence

TATTATTACAACTCTATAAAATTTATATTACAACTAAATTGGAGTATTTCGGTGAGAAAGGCTATGCATCTGGTGTATGAACCCGTTTGCCGTCTGACAC[C/T]
GACAGACGAAGGTGAACGAGTTTTCGGCCGTAGTATCGTAAGCAACGACGATGTTAAGAGCAAGACGGTCAAGTTCGCATTTGGAGTCGTGACGAACGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.20% 4.60% 1.25% 0.00% NA
All Indica  2759 99.80% 0.00% 0.14% 0.00% NA
All Japonica  1512 82.30% 14.20% 3.57% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.20% 0.34% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.00% 0.25% 0.00% NA
Temperate Japonica  767 70.80% 23.10% 6.13% 0.00% NA
Tropical Japonica  504 99.00% 0.40% 0.60% 0.00% NA
Japonica Intermediate  241 83.80% 14.50% 1.66% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1103306604 G -> A LOC_Os11g06760.1 downstream_gene_variant ; 3268.0bp to feature; MODIFIER silent_mutation Average:58.363; most accessible tissue: Minghui63 root, score: 87.819 N N N N
vg1103306604 G -> A LOC_Os11g06770.2 downstream_gene_variant ; 896.0bp to feature; MODIFIER silent_mutation Average:58.363; most accessible tissue: Minghui63 root, score: 87.819 N N N N
vg1103306604 G -> A LOC_Os11g06760.2 downstream_gene_variant ; 3268.0bp to feature; MODIFIER silent_mutation Average:58.363; most accessible tissue: Minghui63 root, score: 87.819 N N N N
vg1103306604 G -> A LOC_Os11g06770.1 downstream_gene_variant ; 967.0bp to feature; MODIFIER silent_mutation Average:58.363; most accessible tissue: Minghui63 root, score: 87.819 N N N N
vg1103306604 G -> A LOC_Os11g06760-LOC_Os11g06770 intergenic_region ; MODIFIER silent_mutation Average:58.363; most accessible tissue: Minghui63 root, score: 87.819 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1103306604 NA 5.42E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103306604 4.79E-06 4.79E-06 mr1474_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251