Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1103156888:

Variant ID: vg1103156888 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 3156888
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 34. )

Flanking Sequence (100 bp) in Reference Genome:


TTAATAAAATATAAAACTATAGATAATATAGCATGCTTGTATGATGTTTAAATATAATACACCCTCCGTTCCAAAATATAAGGCACGACCACCTTTAACG[C/T]
AAAGACCAAAAAATAATTATTATCATATCCTAGTTTGAATCACCCTAATAAATATAATGCATGCATCCAATAGAATTAGAGATCTTGAGGGTGGAGGATT

Reverse complement sequence

AATCCTCCACCCTCAAGATCTCTAATTCTATTGGATGCATGCATTATATTTATTAGGGTGATTCAAACTAGGATATGATAATAATTATTTTTTGGTCTTT[G/A]
CGTTAAAGGTGGTCGTGCCTTATATTTTGGAACGGAGGGTGTATTATATTTAAACATCATACAAGCATGCTATATTATCTATAGTTTTATATTTTATTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.90% 38.90% 0.21% 0.00% NA
All Indica  2759 37.80% 61.80% 0.33% 0.00% NA
All Japonica  1512 95.60% 4.30% 0.07% 0.00% NA
Aus  269 84.40% 15.60% 0.00% 0.00% NA
Indica I  595 90.40% 9.20% 0.34% 0.00% NA
Indica II  465 10.10% 89.20% 0.65% 0.00% NA
Indica III  913 17.70% 82.00% 0.22% 0.00% NA
Indica Intermediate  786 37.80% 62.00% 0.25% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 89.50% 10.50% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 1.70% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1103156888 C -> T LOC_Os11g06540.1 upstream_gene_variant ; 4951.0bp to feature; MODIFIER silent_mutation Average:22.219; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1103156888 C -> T LOC_Os11g06550.1 upstream_gene_variant ; 3695.0bp to feature; MODIFIER silent_mutation Average:22.219; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1103156888 C -> T LOC_Os11g06570.1 upstream_gene_variant ; 2840.0bp to feature; MODIFIER silent_mutation Average:22.219; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1103156888 C -> T LOC_Os11g06560.1 downstream_gene_variant ; 1425.0bp to feature; MODIFIER silent_mutation Average:22.219; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1103156888 C -> T LOC_Os11g06560-LOC_Os11g06570 intergenic_region ; MODIFIER silent_mutation Average:22.219; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1103156888 NA 2.97E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 4.03E-07 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 5.84E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 1.72E-09 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 9.45E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 2.82E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 2.59E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 4.74E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 4.65E-08 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 7.09E-07 mr1186_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 5.34E-06 2.23E-07 mr1245_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 7.23E-08 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 3.46E-07 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 1.29E-07 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 1.23E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 1.73E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 1.29E-12 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 4.62E-07 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 1.94E-18 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 1.75E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 6.89E-15 mr1338_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 1.75E-07 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 6.02E-07 mr1355_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 4.33E-08 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 1.90E-09 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 3.48E-06 3.55E-09 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 1.04E-06 mr1373_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 1.11E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 7.46E-06 mr1445_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 4.63E-06 mr1445_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 1.73E-11 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 4.49E-06 mr1449_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 2.08E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 1.93E-07 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 1.34E-08 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 3.34E-06 mr1497_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 7.21E-09 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 2.77E-06 mr1508_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 4.00E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 2.21E-15 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 2.59E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 2.89E-06 mr1616_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 3.64E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 3.33E-06 mr1655_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 1.75E-06 mr1657_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 2.37E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 1.53E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 4.69E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 2.44E-17 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 3.57E-14 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 2.00E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 2.11E-08 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 2.30E-17 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 3.89E-11 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 4.50E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 1.39E-09 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 6.04E-08 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 2.80E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 8.55E-06 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103156888 NA 5.20E-08 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251