Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103133067:

Variant ID: vg1103133067 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 3133067
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATGCAAGCCTACATGCATGTGGAGACATGAGCTAATATATGTGTGATCGTCTAGGAATAACTTTTTATAAGTTGAGTTGTTTGATGATTAGTCTTTTTT[T/C]
TATATCATGACATTTCAATCAATTATTTAAGGTGCACATGGACTATGATTTATTGTCAAATAAAAAAATAGTGTGATCCCTATACCTGCACATTATACAT

Reverse complement sequence

ATGTATAATGTGCAGGTATAGGGATCACACTATTTTTTTATTTGACAATAAATCATAGTCCATGTGCACCTTAAATAATTGATTGAAATGTCATGATATA[A/G]
AAAAAAGACTAATCATCAAACAACTCAACTTATAAAAAGTTATTCCTAGACGATCACACATATATTAGCTCATGTCTCCACATGCATGTAGGCTTGCATG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.40%	0.30%	0.72%	50.63%	NA
All Indica	2759	22.10%	0.40%	0.83%	76.62%	NA
All Japonica	1512	95.30%	0.00%	0.07%	4.63%	NA
Aus	269	34.20%	0.00%	3.35%	62.45%	NA
Indica I	595	35.00%	0.80%	1.01%	63.19%	NA
Indica II	465	11.60%	1.10%	0.43%	86.88%	NA
Indica III	913	17.00%	0.00%	0.88%	82.15%	NA
Indica Intermediate	786	24.60%	0.30%	0.89%	74.30%	NA
Temperate Japonica	767	97.80%	0.00%	0.00%	2.22%	NA
Tropical Japonica	504	89.70%	0.00%	0.20%	10.12%	NA
Japonica Intermediate	241	99.20%	0.00%	0.00%	0.83%	NA
VI/Aromatic	96	87.50%	0.00%	1.04%	11.46%	NA
Intermediate	90	66.70%	0.00%	0.00%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1103133067	T -> DEL	N	N	silent_mutation	Average:29.872; most accessible tissue: Callus, score: 74.934	N	N	N	N
vg1103133067	T -> C	LOC_Os11g06470.1	downstream_gene_variant ; 3865.0bp to feature; MODIFIER	silent_mutation	Average:29.872; most accessible tissue: Callus, score: 74.934	N	N	N	N
vg1103133067	T -> C	LOC_Os11g06490.1	downstream_gene_variant ; 1819.0bp to feature; MODIFIER	silent_mutation	Average:29.872; most accessible tissue: Callus, score: 74.934	N	N	N	N
vg1103133067	T -> C	LOC_Os11g06500.1	downstream_gene_variant ; 4961.0bp to feature; MODIFIER	silent_mutation	Average:29.872; most accessible tissue: Callus, score: 74.934	N	N	N	N
vg1103133067	T -> C	LOC_Os11g06480.1	intron_variant ; MODIFIER	silent_mutation	Average:29.872; most accessible tissue: Callus, score: 74.934	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1103133067	NA	4.23E-10	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	1.39E-11	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	1.66E-06	mr1585	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	2.03E-06	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	1.98E-07	1.40E-31	mr1855	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	6.19E-07	8.97E-26	mr1855	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	4.36E-07	mr1914	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	3.31E-06	mr1927	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	1.05E-06	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	5.44E-07	mr1253_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	1.94E-06	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	4.35E-07	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	4.93E-12	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	2.18E-15	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	3.50E-06	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	1.92E-06	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	3.12E-10	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	4.28E-13	mr1818_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	1.78E-13	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	1.51E-29	mr1855_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	1.18E-21	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	1.14E-13	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	6.89E-14	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	2.08E-13	mr1914_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	7.66E-16	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067	NA	2.35E-15	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251