\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103133067:

Variant ID: vg1103133067 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 3133067
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGCAAGCCTACATGCATGTGGAGACATGAGCTAATATATGTGTGATCGTCTAGGAATAACTTTTTATAAGTTGAGTTGTTTGATGATTAGTCTTTTTT[T/C]
TATATCATGACATTTCAATCAATTATTTAAGGTGCACATGGACTATGATTTATTGTCAAATAAAAAAATAGTGTGATCCCTATACCTGCACATTATACAT

Reverse complement sequence

ATGTATAATGTGCAGGTATAGGGATCACACTATTTTTTTATTTGACAATAAATCATAGTCCATGTGCACCTTAAATAATTGATTGAAATGTCATGATATA[A/G]
AAAAAAGACTAATCATCAAACAACTCAACTTATAAAAAGTTATTCCTAGACGATCACACATATATTAGCTCATGTCTCCACATGCATGTAGGCTTGCATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.40% 0.30% 0.72% 50.63% NA
All Indica  2759 22.10% 0.40% 0.83% 76.62% NA
All Japonica  1512 95.30% 0.00% 0.07% 4.63% NA
Aus  269 34.20% 0.00% 3.35% 62.45% NA
Indica I  595 35.00% 0.80% 1.01% 63.19% NA
Indica II  465 11.60% 1.10% 0.43% 86.88% NA
Indica III  913 17.00% 0.00% 0.88% 82.15% NA
Indica Intermediate  786 24.60% 0.30% 0.89% 74.30% NA
Temperate Japonica  767 97.80% 0.00% 0.00% 2.22% NA
Tropical Japonica  504 89.70% 0.00% 0.20% 10.12% NA
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.83% NA
VI/Aromatic  96 87.50% 0.00% 1.04% 11.46% NA
Intermediate  90 66.70% 0.00% 0.00% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1103133067 T -> DEL N N silent_mutation Average:29.872; most accessible tissue: Callus, score: 74.934 N N N N
vg1103133067 T -> C LOC_Os11g06470.1 downstream_gene_variant ; 3865.0bp to feature; MODIFIER silent_mutation Average:29.872; most accessible tissue: Callus, score: 74.934 N N N N
vg1103133067 T -> C LOC_Os11g06490.1 downstream_gene_variant ; 1819.0bp to feature; MODIFIER silent_mutation Average:29.872; most accessible tissue: Callus, score: 74.934 N N N N
vg1103133067 T -> C LOC_Os11g06500.1 downstream_gene_variant ; 4961.0bp to feature; MODIFIER silent_mutation Average:29.872; most accessible tissue: Callus, score: 74.934 N N N N
vg1103133067 T -> C LOC_Os11g06480.1 intron_variant ; MODIFIER silent_mutation Average:29.872; most accessible tissue: Callus, score: 74.934 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1103133067 NA 4.23E-10 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 1.39E-11 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 1.66E-06 mr1585 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 2.03E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 1.98E-07 1.40E-31 mr1855 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 6.19E-07 8.97E-26 mr1855 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 4.36E-07 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 3.31E-06 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 1.05E-06 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 5.44E-07 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 1.94E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 4.35E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 4.93E-12 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 2.18E-15 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 3.50E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 1.92E-06 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 3.12E-10 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 4.28E-13 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 1.78E-13 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 1.51E-29 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 1.18E-21 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 1.14E-13 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 6.89E-14 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 2.08E-13 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 7.66E-16 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103133067 NA 2.35E-15 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251