\
| Variant ID: vg1103104667 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 3104667 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 120. )
CGGTCCTTAAACTTGTCAAGAGGTTTCACTTAGGTCCACGAACTTGCAAAGCGCACATCGAGGTCCCTAAACTTGGTTTATTGTATCATCTCGGTCCAAA[G/A]
CCGTGTTTGACCGTGGTCTTGCCTACGTGGCACGCCACGTGGACGATGACATGGATTTTTTATATTTTTTTTCTCCCTTCTTACTTCTTTTTTCTCTTTT
AAAAGAGAAAAAAGAAGTAAGAAGGGAGAAAAAAAATATAAAAAATCCATGTCATCGTCCACGTGGCGTGCCACGTAGGCAAGACCACGGTCAAACACGG[C/T]
TTTGGACCGAGATGATACAATAAACCAAGTTTAGGGACCTCGATGTGCGCTTTGCAAGTTCGTGGACCTAAGTGAAACCTCTTGACAAGTTTAAGGACCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.20% | 33.30% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 44.40% | 54.80% | 0.76% | 0.00% | NA |
| All Japonica | 1512 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 92.60% | 7.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 90.30% | 9.40% | 0.34% | 0.00% | NA |
| Indica II | 465 | 26.90% | 70.10% | 3.01% | 0.00% | NA |
| Indica III | 913 | 25.10% | 74.70% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 42.50% | 57.10% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 22.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1103104667 | G -> A | LOC_Os11g06420.1 | downstream_gene_variant ; 1991.0bp to feature; MODIFIER | silent_mutation | Average:57.188; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg1103104667 | G -> A | LOC_Os11g06430.1 | downstream_gene_variant ; 355.0bp to feature; MODIFIER | silent_mutation | Average:57.188; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg1103104667 | G -> A | LOC_Os11g06420.2 | downstream_gene_variant ; 1991.0bp to feature; MODIFIER | silent_mutation | Average:57.188; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg1103104667 | G -> A | LOC_Os11g06420-LOC_Os11g06430 | intergenic_region ; MODIFIER | silent_mutation | Average:57.188; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1103104667 | NA | 8.21E-06 | mr1377 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 6.38E-06 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 2.56E-06 | mr1041_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 2.98E-07 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 2.97E-07 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 4.95E-07 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 6.81E-07 | mr1293_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 2.24E-06 | mr1294_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 8.90E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 1.50E-06 | mr1360_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 2.09E-08 | mr1360_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 9.04E-08 | mr1373_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 6.99E-06 | mr1373_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 2.73E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 1.52E-06 | mr1420_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 5.32E-07 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 1.15E-06 | mr1492_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 1.10E-06 | mr1497_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 2.55E-08 | mr1508_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 7.22E-07 | mr1508_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 8.59E-06 | mr1519_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 5.38E-06 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 2.27E-07 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 4.37E-06 | mr1616_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 4.45E-06 | mr1657_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 1.61E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 1.99E-08 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 3.35E-08 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 3.52E-10 | mr1715_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 5.05E-07 | mr1756_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 4.77E-07 | mr1779_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 1.89E-14 | mr1794_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 4.74E-09 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1103104667 | NA | 8.61E-08 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |