Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103104667:

Variant ID: vg1103104667 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 3104667
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


CGGTCCTTAAACTTGTCAAGAGGTTTCACTTAGGTCCACGAACTTGCAAAGCGCACATCGAGGTCCCTAAACTTGGTTTATTGTATCATCTCGGTCCAAA[G/A]
CCGTGTTTGACCGTGGTCTTGCCTACGTGGCACGCCACGTGGACGATGACATGGATTTTTTATATTTTTTTTCTCCCTTCTTACTTCTTTTTTCTCTTTT

Reverse complement sequence

AAAAGAGAAAAAAGAAGTAAGAAGGGAGAAAAAAAATATAAAAAATCCATGTCATCGTCCACGTGGCGTGCCACGTAGGCAAGACCACGGTCAAACACGG[C/T]
TTTGGACCGAGATGATACAATAAACCAAGTTTAGGGACCTCGATGTGCGCTTTGCAAGTTCGTGGACCTAAGTGAAACCTCTTGACAAGTTTAAGGACCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.20% 33.30% 0.49% 0.00% NA
All Indica  2759 44.40% 54.80% 0.76% 0.00% NA
All Japonica  1512 98.50% 1.50% 0.00% 0.00% NA
Aus  269 92.60% 7.10% 0.37% 0.00% NA
Indica I  595 90.30% 9.40% 0.34% 0.00% NA
Indica II  465 26.90% 70.10% 3.01% 0.00% NA
Indica III  913 25.10% 74.70% 0.22% 0.00% NA
Indica Intermediate  786 42.50% 57.10% 0.38% 0.00% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 97.60% 2.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1103104667 G -> A LOC_Os11g06420.1 downstream_gene_variant ; 1991.0bp to feature; MODIFIER silent_mutation Average:57.188; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg1103104667 G -> A LOC_Os11g06430.1 downstream_gene_variant ; 355.0bp to feature; MODIFIER silent_mutation Average:57.188; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg1103104667 G -> A LOC_Os11g06420.2 downstream_gene_variant ; 1991.0bp to feature; MODIFIER silent_mutation Average:57.188; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg1103104667 G -> A LOC_Os11g06420-LOC_Os11g06430 intergenic_region ; MODIFIER silent_mutation Average:57.188; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1103104667 NA 8.21E-06 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 6.38E-06 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 2.56E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 2.98E-07 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 2.97E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 4.95E-07 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 6.81E-07 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 2.24E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 8.90E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 1.50E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 2.09E-08 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 9.04E-08 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 6.99E-06 mr1373_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 2.73E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 1.52E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 5.32E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 1.15E-06 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 1.10E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 2.55E-08 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 7.22E-07 mr1508_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 8.59E-06 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 5.38E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 2.27E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 4.37E-06 mr1616_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 4.45E-06 mr1657_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 1.61E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 1.99E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 3.35E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 3.52E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 5.05E-07 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 4.77E-07 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 1.89E-14 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 4.74E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103104667 NA 8.61E-08 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251