Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103059501:

Variant ID: vg1103059501 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 3059501
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 38. )

Flanking Sequence (100 bp) in Reference Genome:

CAGCTACAATCCTTATGGGTTTCATCCTTGTCAAACTTAGTGTCCTATACTTTTTACAAAAATCATTATCCTATTGCTGCCTCTAGCAAACTCAAAGTCT[T/C]
GTACTATATATGCTGCTGATGACCGAACAAATTCTTGAGAATGTCAAGAATATATGTAACTATTAGACTCCATGTACAATACAACCAAATTTTAATCACT

Reverse complement sequence

AGTGATTAAAATTTGGTTGTATTGTACATGGAGTCTAATAGTTACATATATTCTTGACATTCTCAAGAATTTGTTCGGTCATCAGCAGCATATATAGTAC[A/G]
AGACTTTGAGTTTGCTAGAGGCAGCAATAGGATAATGATTTTTGTAAAAAGTATAGGACACTAAGTTTGACAAGGATGAAACCCATAAGGATTGTAGCTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.30%	4.90%	2.58%	49.26%	NA
All Indica	2759	20.60%	7.60%	3.88%	67.92%	NA
All Japonica	1512	83.20%	0.70%	0.40%	15.74%	NA
Aus	269	30.10%	1.10%	2.60%	66.17%	NA
Indica I	595	30.90%	2.40%	3.53%	63.19%	NA
Indica II	465	8.40%	28.20%	6.02%	57.42%	NA
Indica III	913	18.60%	0.30%	2.19%	78.86%	NA
Indica Intermediate	786	22.10%	8.00%	4.83%	65.01%	NA
Temperate Japonica	767	76.40%	1.00%	0.39%	22.16%	NA
Tropical Japonica	504	87.70%	0.20%	0.40%	11.71%	NA
Japonica Intermediate	241	95.40%	0.40%	0.41%	3.73%	NA
VI/Aromatic	96	87.50%	0.00%	0.00%	12.50%	NA
Intermediate	90	60.00%	8.90%	2.22%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1103059501	T -> DEL	N	N	silent_mutation	Average:37.152; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg1103059501	T -> C	LOC_Os11g06360.1	upstream_gene_variant ; 4173.0bp to feature; MODIFIER	silent_mutation	Average:37.152; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg1103059501	T -> C	LOC_Os11g06370.1	downstream_gene_variant ; 4020.0bp to feature; MODIFIER	silent_mutation	Average:37.152; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg1103059501	T -> C	LOC_Os11g06360-LOC_Os11g06370	intergenic_region ; MODIFIER	silent_mutation	Average:37.152; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1103059501	NA	2.69E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	3.77E-12	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	6.51E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	3.31E-07	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	2.19E-06	mr1041_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	1.55E-17	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	5.02E-07	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	1.57E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	3.25E-07	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	6.27E-08	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	5.57E-06	mr1294_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	3.86E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	5.98E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	1.31E-10	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	2.56E-07	mr1373_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	1.03E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	8.56E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	1.25E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	8.47E-09	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	2.09E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	3.79E-06	mr1492_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	9.87E-09	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	7.67E-08	mr1497_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	1.50E-08	mr1508_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	1.45E-06	mr1508_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	8.34E-07	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	6.72E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	1.18E-10	mr1565_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	1.33E-09	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	2.74E-08	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	3.34E-09	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	2.61E-08	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	6.56E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	1.10E-16	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	8.88E-12	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	3.34E-07	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	2.15E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	4.37E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	4.25E-08	mr1861_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501	NA	5.75E-07	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251