\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103059501:

Variant ID: vg1103059501 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 3059501
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 38. )

Flanking Sequence (100 bp) in Reference Genome:


CAGCTACAATCCTTATGGGTTTCATCCTTGTCAAACTTAGTGTCCTATACTTTTTACAAAAATCATTATCCTATTGCTGCCTCTAGCAAACTCAAAGTCT[T/C]
GTACTATATATGCTGCTGATGACCGAACAAATTCTTGAGAATGTCAAGAATATATGTAACTATTAGACTCCATGTACAATACAACCAAATTTTAATCACT

Reverse complement sequence

AGTGATTAAAATTTGGTTGTATTGTACATGGAGTCTAATAGTTACATATATTCTTGACATTCTCAAGAATTTGTTCGGTCATCAGCAGCATATATAGTAC[A/G]
AGACTTTGAGTTTGCTAGAGGCAGCAATAGGATAATGATTTTTGTAAAAAGTATAGGACACTAAGTTTGACAAGGATGAAACCCATAAGGATTGTAGCTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.30% 4.90% 2.58% 49.26% NA
All Indica  2759 20.60% 7.60% 3.88% 67.92% NA
All Japonica  1512 83.20% 0.70% 0.40% 15.74% NA
Aus  269 30.10% 1.10% 2.60% 66.17% NA
Indica I  595 30.90% 2.40% 3.53% 63.19% NA
Indica II  465 8.40% 28.20% 6.02% 57.42% NA
Indica III  913 18.60% 0.30% 2.19% 78.86% NA
Indica Intermediate  786 22.10% 8.00% 4.83% 65.01% NA
Temperate Japonica  767 76.40% 1.00% 0.39% 22.16% NA
Tropical Japonica  504 87.70% 0.20% 0.40% 11.71% NA
Japonica Intermediate  241 95.40% 0.40% 0.41% 3.73% NA
VI/Aromatic  96 87.50% 0.00% 0.00% 12.50% NA
Intermediate  90 60.00% 8.90% 2.22% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1103059501 T -> DEL N N silent_mutation Average:37.152; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg1103059501 T -> C LOC_Os11g06360.1 upstream_gene_variant ; 4173.0bp to feature; MODIFIER silent_mutation Average:37.152; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg1103059501 T -> C LOC_Os11g06370.1 downstream_gene_variant ; 4020.0bp to feature; MODIFIER silent_mutation Average:37.152; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg1103059501 T -> C LOC_Os11g06360-LOC_Os11g06370 intergenic_region ; MODIFIER silent_mutation Average:37.152; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1103059501 NA 2.69E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 3.77E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 6.51E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 3.31E-07 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 2.19E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 1.55E-17 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 5.02E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 1.57E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 3.25E-07 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 6.27E-08 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 5.57E-06 mr1294_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 3.86E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 5.98E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 1.31E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 2.56E-07 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 1.03E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 8.56E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 1.25E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 8.47E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 2.09E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 3.79E-06 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 9.87E-09 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 7.67E-08 mr1497_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 1.50E-08 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 1.45E-06 mr1508_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 8.34E-07 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 6.72E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 1.18E-10 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 1.33E-09 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 2.74E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 3.34E-09 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 2.61E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 6.56E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 1.10E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 8.88E-12 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 3.34E-07 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 2.15E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 4.37E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 4.25E-08 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103059501 NA 5.75E-07 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251