Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103055570:

Variant ID: vg1103055570 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 3055570
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAGTGAAGAACGCGGTTTGGTGGCGGTGGCGCCCTTCGTCGGTGGGCTTCGGTTTGGGGTGCTCCCTGGCCGGGGACGACAGCGCGGAACTTCTCCTTG[C/T]
CGTCGCTGTGGTTGCGGCCGATGACGAGCTTGCTGATGCAGCGCCACCACGTGATGGACCCCGTCGACCCGCTCTTCCGTGGGGGGCGCGACGGCGAGGA

Reverse complement sequence

TCCTCGCCGTCGCGCCCCCCACGGAAGAGCGGGTCGACGGGGTCCATCACGTGGTGGCGCTGCATCAGCAAGCTCGTCATCGGCCGCAACCACAGCGACG[G/A]
CAAGGAGAAGTTCCGCGCTGTCGTCCCCGGCCAGGGAGCACCCCAAACCGAAGCCCACCGACGAAGGGCGCCACCGCCACCAAACCGCGTTCTTCACTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.10% 5.50% 1.23% 1.18% NA
All Indica  2759 93.10% 4.80% 1.49% 0.62% NA
All Japonica  1512 97.50% 0.00% 0.13% 2.38% NA
Aus  269 51.70% 43.50% 4.46% 0.37% NA
Indica I  595 79.80% 17.00% 3.03% 0.17% NA
Indica II  465 98.30% 0.00% 1.29% 0.43% NA
Indica III  913 98.00% 0.50% 0.44% 0.99% NA
Indica Intermediate  786 94.40% 3.30% 1.65% 0.64% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 92.50% 0.00% 0.40% 7.14% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 5.20% 2.08% 2.08% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1103055570 C -> T LOC_Os11g06360.1 upstream_gene_variant ; 242.0bp to feature; MODIFIER silent_mutation Average:84.412; most accessible tissue: Zhenshan97 panicle, score: 92.133 N N N N
vg1103055570 C -> T LOC_Os11g06360-LOC_Os11g06370 intergenic_region ; MODIFIER silent_mutation Average:84.412; most accessible tissue: Zhenshan97 panicle, score: 92.133 N N N N
vg1103055570 C -> DEL N N silent_mutation Average:84.412; most accessible tissue: Zhenshan97 panicle, score: 92.133 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1103055570 C T -0.02 -0.02 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1103055570 NA 1.43E-10 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103055570 NA 1.01E-06 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103055570 NA 2.98E-07 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103055570 NA 1.19E-06 mr1544 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103055570 3.89E-06 3.88E-06 mr1688 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103055570 NA 2.43E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251