\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102726033:

Variant ID: vg1102726033 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 2726033
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


TCGACATGGCGGTCTGAAGGTCTGACTCGTAGTCGACAACAGGGTAGCCTTCCTCCTCGAGTTCGCGCCCGACGGAATCAGAGACAGTGCTAGATCCCTA[C/T]
GGCCGGCCTCTGAAGGTACCGGATAGGGTCGATCCAGGCGTATCTCTGATGTCGATATCCGGCGGCTTGTCTTGGCGTATGTAGGCTTCTATGTTGATTG

Reverse complement sequence

CAATCAACATAGAAGCCTACATACGCCAAGACAAGCCGCCGGATATCGACATCAGAGATACGCCTGGATCGACCCTATCCGGTACCTTCAGAGGCCGGCC[G/A]
TAGGGATCTAGCACTGTCTCTGATTCCGTCGGGCGCGAACTCGAGGAGGAAGGCTACCCTGTTGTCGACTACGAGTCAGACCTTCAGACCGCCATGTCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.60% 25.90% 0.17% 0.34% NA
All Indica  2759 56.90% 42.30% 0.22% 0.58% NA
All Japonica  1512 99.40% 0.50% 0.07% 0.00% NA
Aus  269 87.00% 12.60% 0.37% 0.00% NA
Indica I  595 83.00% 16.60% 0.00% 0.34% NA
Indica II  465 23.00% 75.50% 0.43% 1.08% NA
Indica III  913 60.80% 38.60% 0.00% 0.66% NA
Indica Intermediate  786 52.80% 46.30% 0.51% 0.38% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1102726033 C -> T LOC_Os11g05840.1 upstream_gene_variant ; 1758.0bp to feature; MODIFIER silent_mutation Average:60.003; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N
vg1102726033 C -> T LOC_Os11g05850.2 upstream_gene_variant ; 4110.0bp to feature; MODIFIER silent_mutation Average:60.003; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N
vg1102726033 C -> T LOC_Os11g05840-LOC_Os11g05850 intergenic_region ; MODIFIER silent_mutation Average:60.003; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N
vg1102726033 C -> DEL N N silent_mutation Average:60.003; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1102726033 NA 4.49E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102726033 NA 2.66E-06 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102726033 NA 2.66E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102726033 NA 1.91E-08 mr1835 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102726033 NA 3.71E-07 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102726033 NA 8.37E-07 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102726033 NA 4.53E-06 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102726033 NA 6.43E-06 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102726033 NA 6.25E-10 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102726033 NA 1.28E-11 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102726033 NA 5.85E-19 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102726033 NA 3.54E-11 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102726033 NA 2.62E-10 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102726033 NA 2.24E-07 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102726033 NA 1.08E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102726033 NA 7.58E-06 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102726033 NA 7.27E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102726033 NA 1.88E-09 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102726033 NA 5.18E-06 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102726033 NA 3.05E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102726033 NA 2.76E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251