Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102616547:

Variant ID: vg1102616547 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 2616547
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:

TATTTGCGGCTTGTTTGGTAACTCAAGGAAAGAGGATTGGAAGTTTACACGAGGGAATTGATGATGAGATTAAGATGGGAATTTAATTTTTAATCCCAAT[A/G]
TCTTGTTTGGTAGAGGTGATGGAAATTAATAGGGAGTTTAGTTGGAGATTAGGTCATTCATAAAAACCGGTGGCTGAGATTTGCTTAGACAAAGTAAAGG

Reverse complement sequence

CCTTTACTTTGTCTAAGCAAATCTCAGCCACCGGTTTTTATGAATGACCTAATCTCCAACTAAACTCCCTATTAATTTCCATCACCTCTACCAAACAAGA[T/C]
ATTGGGATTAAAAATTAAATTCCCATCTTAATCTCATCATCAATTCCCTCGTGTAAACTTCCAATCCTCTTTCCTTGAGTTACCAAACAAGCCGCAAATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.60%	3.40%	0.72%	9.35%	NA
All Indica	2759	79.20%	5.50%	1.12%	14.10%	NA
All Japonica	1512	97.20%	0.10%	0.00%	2.65%	NA
Aus	269	95.90%	0.40%	0.74%	2.97%	NA
Indica I	595	87.20%	0.00%	0.50%	12.27%	NA
Indica II	465	70.80%	18.90%	2.15%	8.17%	NA
Indica III	913	78.90%	2.10%	1.10%	17.96%	NA
Indica Intermediate	786	78.60%	5.90%	1.02%	14.50%	NA
Temperate Japonica	767	99.50%	0.30%	0.00%	0.26%	NA
Tropical Japonica	504	92.70%	0.00%	0.00%	7.34%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	95.80%	0.00%	0.00%	4.17%	NA
Intermediate	90	94.40%	3.30%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1102616547	A -> DEL	N	N	silent_mutation	Average:25.548; most accessible tissue: Minghui63 flag leaf, score: 48.324	N	N	N	N
vg1102616547	A -> G	LOC_Os11g05710.1	upstream_gene_variant ; 1813.0bp to feature; MODIFIER	silent_mutation	Average:25.548; most accessible tissue: Minghui63 flag leaf, score: 48.324	N	N	N	N
vg1102616547	A -> G	LOC_Os11g05720.1	upstream_gene_variant ; 4458.0bp to feature; MODIFIER	silent_mutation	Average:25.548; most accessible tissue: Minghui63 flag leaf, score: 48.324	N	N	N	N
vg1102616547	A -> G	LOC_Os11g05700-LOC_Os11g05710	intergenic_region ; MODIFIER	silent_mutation	Average:25.548; most accessible tissue: Minghui63 flag leaf, score: 48.324	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1102616547	NA	3.95E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102616547	NA	2.83E-06	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102616547	NA	3.65E-07	mr1415	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102616547	NA	3.65E-07	mr1567	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102616547	1.38E-06	NA	mr1668	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102616547	NA	2.89E-06	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102616547	2.48E-06	2.48E-06	mr1992	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102616547	NA	7.53E-08	mr1828_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251