Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1102581158:

Variant ID: vg1102581158 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 2581158
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, C: 0.20, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGCTGTTTGATACTACTCCACCTCCCTCCTAAGAGCAAGGTCAATAGTATAGCCAACTACTGGCTCCAAAACATTTATAGCCAATCTAATAGCTAATT[T/C]
ATACAATAGTTAACTATAAAAATATACTACACTATTAATACCCAGTCCCACTTCTCATACACACATAACATCTTGAAGTCCGTGTTGCAGCCGGCTACAA

Reverse complement sequence

TTGTAGCCGGCTGCAACACGGACTTCAAGATGTTATGTGTGTATGAGAAGTGGGACTGGGTATTAATAGTGTAGTATATTTTTATAGTTAACTATTGTAT[A/G]
AATTAGCTATTAGATTGGCTATAAATGTTTTGGAGCCAGTAGTTGGCTATACTATTGACCTTGCTCTTAGGAGGGAGGTGGAGTAGTATCAAACAGCAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.30% 22.30% 0.36% 0.00% NA
All Indica  2759 69.30% 30.00% 0.62% 0.00% NA
All Japonica  1512 96.40% 3.60% 0.00% 0.00% NA
Aus  269 44.60% 55.40% 0.00% 0.00% NA
Indica I  595 26.10% 73.90% 0.00% 0.00% NA
Indica II  465 89.20% 10.80% 0.00% 0.00% NA
Indica III  913 88.50% 10.20% 1.31% 0.00% NA
Indica Intermediate  786 68.10% 31.30% 0.64% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 91.30% 8.70% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1102581158 T -> C LOC_Os11g05680.1 upstream_gene_variant ; 2856.0bp to feature; MODIFIER silent_mutation Average:71.312; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg1102581158 T -> C LOC_Os11g05680-LOC_Os11g05690 intergenic_region ; MODIFIER silent_mutation Average:71.312; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1102581158 T C -0.02 -0.03 -0.01 -0.07 -0.05 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1102581158 NA 4.58E-13 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1102581158 NA 1.64E-10 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1102581158 NA 3.52E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102581158 NA 2.86E-08 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102581158 NA 7.68E-06 mr1081 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102581158 NA 4.19E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102581158 NA 1.29E-07 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102581158 NA 5.97E-08 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102581158 NA 3.94E-07 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102581158 NA 1.36E-10 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102581158 NA 7.20E-09 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102581158 1.75E-06 8.50E-11 mr1397 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102581158 NA 6.39E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102581158 NA 1.06E-11 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102581158 NA 4.15E-08 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102581158 NA 6.32E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102581158 NA 5.96E-06 mr1680 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102581158 NA 2.77E-12 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102581158 NA 6.30E-10 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102581158 NA 3.54E-08 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102581158 NA 3.20E-07 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102581158 NA 9.77E-08 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102581158 NA 1.86E-10 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102581158 NA 1.88E-06 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251