\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102473089:

Variant ID: vg1102473089 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 2473089
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTGACGGGACTTCTAGACAATAAAAAATGAATTCCAACGATAGTTATGTTCGATTTTTATAATCACAATGATAATAAAGAGTTGGCGACGGACGGACT[G/A]
TAGAGGGGCATAGTGGCATTGTTTGATGGGACTTCTAAAAGTTATAAAAAAATGAAACTACAAGTCCAATTTTTAAAGGTTTGGAACTTCTAAAAAGTAA

Reverse complement sequence

TTACTTTTTAGAAGTTCCAAACCTTTAAAAATTGGACTTGTAGTTTCATTTTTTTATAACTTTTAGAAGTCCCATCAAACAATGCCACTATGCCCCTCTA[C/T]
AGTCCGTCCGTCGCCAACTCTTTATTATCATTGTGATTATAAAAATCGAACATAACTATCGTTGGAATTCATTTTTTATTGTCTAGAAGTCCCGTCAACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.10% 25.40% 1.44% 0.00% NA
All Indica  2759 69.20% 30.40% 0.36% 0.00% NA
All Japonica  1512 79.80% 16.40% 3.77% 0.00% NA
Aus  269 66.90% 33.10% 0.00% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 42.80% 56.80% 0.43% 0.00% NA
Indica III  913 61.10% 38.90% 0.00% 0.00% NA
Indica Intermediate  786 71.80% 27.20% 1.02% 0.00% NA
Temperate Japonica  767 92.00% 4.40% 3.52% 0.00% NA
Tropical Japonica  504 69.20% 28.00% 2.78% 0.00% NA
Japonica Intermediate  241 63.10% 30.30% 6.64% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1102473089 G -> A LOC_Os11g05480.1 upstream_gene_variant ; 4356.0bp to feature; MODIFIER silent_mutation Average:31.781; most accessible tissue: Minghui63 root, score: 51.763 N N N N
vg1102473089 G -> A LOC_Os11g05490.1 downstream_gene_variant ; 3566.0bp to feature; MODIFIER silent_mutation Average:31.781; most accessible tissue: Minghui63 root, score: 51.763 N N N N
vg1102473089 G -> A LOC_Os11g05480-LOC_Os11g05490 intergenic_region ; MODIFIER silent_mutation Average:31.781; most accessible tissue: Minghui63 root, score: 51.763 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1102473089 4.10E-06 4.44E-10 mr1232 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102473089 NA 4.24E-07 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102473089 NA 1.69E-06 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102473089 NA 9.59E-07 mr1333 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102473089 NA 3.50E-06 mr1544 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102473089 NA 3.24E-09 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102473089 NA 1.34E-09 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102473089 NA 8.94E-10 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102473089 NA 1.90E-08 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102473089 NA 7.90E-07 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102473089 NA 3.50E-07 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102473089 NA 5.44E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102473089 NA 9.05E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102473089 NA 4.57E-10 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102473089 NA 1.31E-12 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102473089 NA 4.16E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102473089 NA 1.12E-09 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102473089 NA 8.69E-10 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251