Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102449959:

Variant ID: vg1102449959 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 2449959
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

CGTGTGTTTCCACAGCTTGTTCGTCGATCACTTAGGGAAACCTGTCACTTAAGGGCGGCGGAGCTCGACGACGAGGCGGCCTTTCCGTGATGCGACGAGG[C/T]
GGGAGTTCTTGAAGAGGCCGGGGTTGTCAAACACCCTGTCAAGCTCGCCGCCGCCGAACCTGGAGGAGGCCGAGGGCAACGGGATGAACCGAGGCAGCGC

Reverse complement sequence

GCGCTGCCTCGGTTCATCCCGTTGCCCTCGGCCTCCTCCAGGTTCGGCGGCGGCGAGCTTGACAGGGTGTTTGACAACCCCGGCCTCTTCAAGAACTCCC[G/A]
CCTCGTCGCATCACGGAAAGGCCGCCTCGTCGTCGAGCTCCGCCGCCCTTAAGTGACAGGTTTCCCTAAGTGATCGACGAACAAGCTGTGGAAACACACG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.90%	19.60%	0.42%	0.00%	NA
All Indica	2759	70.30%	29.00%	0.72%	0.00%	NA
All Japonica	1512	98.50%	1.50%	0.00%	0.00%	NA
Aus	269	66.50%	33.50%	0.00%	0.00%	NA
Indica I	595	99.20%	0.70%	0.17%	0.00%	NA
Indica II	465	43.90%	55.50%	0.65%	0.00%	NA
Indica III	913	62.40%	36.90%	0.66%	0.00%	NA
Indica Intermediate	786	73.30%	25.40%	1.27%	0.00%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	97.00%	3.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1102449959	C -> T	LOC_Os11g05460.1	missense_variant ; p.Arg113His; MODERATE	nonsynonymous_codon ; R113H	Average:52.638; most accessible tissue: Zhenshan97 panicle, score: 79.071	probably damaging	2.235	TOLERATED	0.16

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1102449959	NA	7.99E-06	mr1333	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449959	NA	4.62E-07	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449959	NA	1.52E-06	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449959	NA	2.53E-09	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449959	NA	4.77E-07	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449959	NA	1.37E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449959	NA	3.76E-06	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449959	NA	3.57E-06	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449959	NA	1.76E-08	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449959	NA	1.23E-06	mr1592_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449959	NA	6.31E-12	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449959	NA	7.46E-06	mr1611_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449959	NA	2.46E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449959	NA	5.90E-07	mr1805_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449959	NA	4.82E-09	mr1829_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449959	NA	1.16E-06	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251