\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102449333:

Variant ID: vg1102449333 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 2449333
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCGAATCTCCCCCATCGTCTTTCGGATTGCCGGCGGCGGCGGTAGCTAGCCCCGCCCCCGTGGTGAGGTCCGTCCCGCCGGATAGCTTGCGCTCGGTG[C/T]
TCCAGGACTTGGTGTCCGACGAGTAGGACCGGCACGCCGTGAAGCTACGACGCTTGTAGAGGACCAATAGGCGGAAGGCGGCGGGACCCGGTGGGAGCGG

Reverse complement sequence

CCGCTCCCACCGGGTCCCGCCGCCTTCCGCCTATTGGTCCTCTACAAGCGTCGTAGCTTCACGGCGTGCCGGTCCTACTCGTCGGACACCAAGTCCTGGA[G/A]
CACCGAGCGCAAGCTATCCGGCGGGACGGACCTCACCACGGGGGCGGGGCTAGCTACCGCCGCCGCCGGCAATCCGAAAGACGATGGGGGAGATTCGCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.90% 38.10% 0.02% 0.00% NA
All Indica  2759 37.90% 62.10% 0.04% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 76.20% 23.80% 0.00% 0.00% NA
Indica I  595 4.00% 95.80% 0.17% 0.00% NA
Indica II  465 59.80% 40.20% 0.00% 0.00% NA
Indica III  913 44.20% 55.80% 0.00% 0.00% NA
Indica Intermediate  786 43.30% 56.70% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1102449333 C -> T LOC_Os11g05440.1 upstream_gene_variant ; 3629.0bp to feature; MODIFIER silent_mutation Average:78.023; most accessible tissue: Zhenshan97 panicle, score: 94.195 N N N N
vg1102449333 C -> T LOC_Os11g05450.1 downstream_gene_variant ; 714.0bp to feature; MODIFIER silent_mutation Average:78.023; most accessible tissue: Zhenshan97 panicle, score: 94.195 N N N N
vg1102449333 C -> T LOC_Os11g05460.1 downstream_gene_variant ; 574.0bp to feature; MODIFIER silent_mutation Average:78.023; most accessible tissue: Zhenshan97 panicle, score: 94.195 N N N N
vg1102449333 C -> T LOC_Os11g05470.1 downstream_gene_variant ; 3192.0bp to feature; MODIFIER silent_mutation Average:78.023; most accessible tissue: Zhenshan97 panicle, score: 94.195 N N N N
vg1102449333 C -> T LOC_Os11g05450-LOC_Os11g05460 intergenic_region ; MODIFIER silent_mutation Average:78.023; most accessible tissue: Zhenshan97 panicle, score: 94.195 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1102449333 C T 0.01 0.0 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1102449333 NA 6.22E-06 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449333 NA 5.62E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449333 NA 2.45E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449333 NA 2.22E-09 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449333 9.17E-09 1.18E-28 mr1598 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449333 5.06E-07 6.39E-12 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449333 NA 2.51E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449333 NA 2.26E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449333 NA 2.47E-09 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449333 NA 8.34E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449333 NA 6.33E-06 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449333 NA 9.93E-07 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449333 NA 1.35E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449333 NA 6.02E-40 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449333 NA 1.36E-12 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449333 NA 7.70E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449333 NA 2.29E-14 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102449333 NA 3.23E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251