\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102378690:

Variant ID: vg1102378690 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 2378690
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


GACACTTCGAATAAGTGGAAAGGGTTGCATGCATGTATAAGCAAAAATAATTTTGCCGCTGCAAGCATACATGCAAAGCTATTACATAGTCATATTTTAT[C/A]
TTGACACATAGACCAAGGATAATTAATTCTACTTATCACCCATTTAAACATGCTACTAGTAATTCCTCGTAAACAAGCGATTCATTAATATTTACATTTC

Reverse complement sequence

GAAATGTAAATATTAATGAATCGCTTGTTTACGAGGAATTACTAGTAGCATGTTTAAATGGGTGATAAGTAGAATTAATTATCCTTGGTCTATGTGTCAA[G/T]
ATAAAATATGACTATGTAATAGCTTTGCATGTATGCTTGCAGCGGCAAAATTATTTTTGCTTATACATGCATGCAACCCTTTCCACTTATTCGAAGTGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 15.80% 11.62% 6.09% NA
All Indica  2759 48.70% 23.20% 18.92% 9.21% NA
All Japonica  1512 98.40% 1.30% 0.00% 0.26% NA
Aus  269 56.10% 27.10% 8.55% 8.18% NA
Indica I  595 60.00% 0.80% 31.93% 7.23% NA
Indica II  465 25.20% 52.90% 14.41% 7.53% NA
Indica III  913 49.60% 23.80% 15.55% 11.06% NA
Indica Intermediate  786 52.90% 21.90% 15.65% 9.54% NA
Temperate Japonica  767 98.80% 0.80% 0.00% 0.39% NA
Tropical Japonica  504 97.20% 2.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 93.80% 0.00% 0.00% 6.25% NA
Intermediate  90 76.70% 16.70% 4.44% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1102378690 C -> A LOC_Os11g05350.1 upstream_gene_variant ; 2208.0bp to feature; MODIFIER silent_mutation Average:52.641; most accessible tissue: Callus, score: 86.553 N N N N
vg1102378690 C -> A LOC_Os11g05360.1 upstream_gene_variant ; 449.0bp to feature; MODIFIER silent_mutation Average:52.641; most accessible tissue: Callus, score: 86.553 N N N N
vg1102378690 C -> A LOC_Os11g05370.1 downstream_gene_variant ; 3494.0bp to feature; MODIFIER silent_mutation Average:52.641; most accessible tissue: Callus, score: 86.553 N N N N
vg1102378690 C -> A LOC_Os11g05350-LOC_Os11g05360 intergenic_region ; MODIFIER silent_mutation Average:52.641; most accessible tissue: Callus, score: 86.553 N N N N
vg1102378690 C -> DEL N N silent_mutation Average:52.641; most accessible tissue: Callus, score: 86.553 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1102378690 NA 2.39E-06 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 NA 1.82E-07 mr1333 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 NA 5.95E-09 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 1.68E-07 NA mr1598 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 9.29E-07 2.73E-11 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 NA 7.37E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 NA 4.93E-10 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 NA 5.41E-09 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 NA 5.71E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 NA 1.42E-07 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 NA 7.68E-07 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 NA 2.48E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 NA 2.26E-06 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 NA 1.94E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 NA 1.17E-12 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 NA 6.92E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 NA 4.03E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 NA 1.87E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 NA 6.75E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 NA 2.23E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 NA 1.81E-09 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 NA 1.09E-06 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690 NA 1.20E-10 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251