Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102378690:

Variant ID: vg1102378690 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 2378690
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

GACACTTCGAATAAGTGGAAAGGGTTGCATGCATGTATAAGCAAAAATAATTTTGCCGCTGCAAGCATACATGCAAAGCTATTACATAGTCATATTTTAT[C/A]
TTGACACATAGACCAAGGATAATTAATTCTACTTATCACCCATTTAAACATGCTACTAGTAATTCCTCGTAAACAAGCGATTCATTAATATTTACATTTC

Reverse complement sequence

GAAATGTAAATATTAATGAATCGCTTGTTTACGAGGAATTACTAGTAGCATGTTTAAATGGGTGATAAGTAGAATTAATTATCCTTGGTCTATGTGTCAA[G/T]
ATAAAATATGACTATGTAATAGCTTTGCATGTATGCTTGCAGCGGCAAAATTATTTTTGCTTATACATGCATGCAACCCTTTCCACTTATTCGAAGTGTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.50%	15.80%	11.62%	6.09%	NA
All Indica	2759	48.70%	23.20%	18.92%	9.21%	NA
All Japonica	1512	98.40%	1.30%	0.00%	0.26%	NA
Aus	269	56.10%	27.10%	8.55%	8.18%	NA
Indica I	595	60.00%	0.80%	31.93%	7.23%	NA
Indica II	465	25.20%	52.90%	14.41%	7.53%	NA
Indica III	913	49.60%	23.80%	15.55%	11.06%	NA
Indica Intermediate	786	52.90%	21.90%	15.65%	9.54%	NA
Temperate Japonica	767	98.80%	0.80%	0.00%	0.39%	NA
Tropical Japonica	504	97.20%	2.80%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	93.80%	0.00%	0.00%	6.25%	NA
Intermediate	90	76.70%	16.70%	4.44%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1102378690	C -> A	LOC_Os11g05350.1	upstream_gene_variant ; 2208.0bp to feature; MODIFIER	silent_mutation	Average:52.641; most accessible tissue: Callus, score: 86.553	N	N	N	N
vg1102378690	C -> A	LOC_Os11g05360.1	upstream_gene_variant ; 449.0bp to feature; MODIFIER	silent_mutation	Average:52.641; most accessible tissue: Callus, score: 86.553	N	N	N	N
vg1102378690	C -> A	LOC_Os11g05370.1	downstream_gene_variant ; 3494.0bp to feature; MODIFIER	silent_mutation	Average:52.641; most accessible tissue: Callus, score: 86.553	N	N	N	N
vg1102378690	C -> A	LOC_Os11g05350-LOC_Os11g05360	intergenic_region ; MODIFIER	silent_mutation	Average:52.641; most accessible tissue: Callus, score: 86.553	N	N	N	N
vg1102378690	C -> DEL	N	N	silent_mutation	Average:52.641; most accessible tissue: Callus, score: 86.553	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1102378690	NA	2.39E-06	mr1232	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	NA	1.82E-07	mr1333	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	NA	5.95E-09	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	1.68E-07	NA	mr1598	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	9.29E-07	2.73E-11	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	NA	7.37E-06	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	NA	4.93E-10	mr1141_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	NA	5.41E-09	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	NA	5.71E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	NA	1.42E-07	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	NA	7.68E-07	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	NA	2.48E-06	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	NA	2.26E-06	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	NA	1.94E-08	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	NA	1.17E-12	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	NA	6.92E-08	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	NA	4.03E-06	mr1659_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	NA	1.87E-09	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	NA	6.75E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	NA	2.23E-07	mr1805_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	NA	1.81E-09	mr1829_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	NA	1.09E-06	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102378690	NA	1.20E-10	mr1902_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251