Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102375085:

Variant ID: vg1102375085 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 2375085
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.02, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

GGTAATTTTTTTATGTGTTCACTTAAAAAAACATAAAAAAAAAGAAACTACGTTCGAAATACCTTAAAATCAAATCTAAAATTTAGTTTTAAAATTCAAT[T/A]
TTTAGCAGCGACGTGTTGTTCATGAATGGGTTGCAGGAATGATCTGGGGGGCATTGGTAGATTGAAAGTGGGATGGCAATCACATGTTCATACGATAAGA

Reverse complement sequence

TCTTATCGTATGAACATGTGATTGCCATCCCACTTTCAATCTACCAATGCCCCCCAGATCATTCCTGCAACCCATTCATGAACAACACGTCGCTGCTAAA[A/T]
ATTGAATTTTAAAACTAAATTTTAGATTTGATTTTAAGGTATTTCGAACGTAGTTTCTTTTTTTTTATGTTTTTTTAAGTGAACACATAAAAAAATTACC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.90%	17.10%	0.02%	0.00%	NA
All Indica	2759	77.40%	22.60%	0.00%	0.00%	NA
All Japonica	1512	99.10%	0.90%	0.00%	0.00%	NA
Aus	269	62.10%	37.90%	0.00%	0.00%	NA
Indica I	595	21.20%	78.80%	0.00%	0.00%	NA
Indica II	465	97.60%	2.40%	0.00%	0.00%	NA
Indica III	913	98.10%	1.90%	0.00%	0.00%	NA
Indica Intermediate	786	83.80%	16.20%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	95.90%	4.10%	0.00%	0.00%	NA
VI/Aromatic	96	38.50%	60.40%	1.04%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1102375085	T -> A	LOC_Os11g05340.1	upstream_gene_variant ; 2949.0bp to feature; MODIFIER	silent_mutation	Average:58.458; most accessible tissue: Callus, score: 77.129	N	N	N	N
vg1102375085	T -> A	LOC_Os11g05360.1	upstream_gene_variant ; 4054.0bp to feature; MODIFIER	silent_mutation	Average:58.458; most accessible tissue: Callus, score: 77.129	N	N	N	N
vg1102375085	T -> A	LOC_Os11g05350.1	downstream_gene_variant ; 924.0bp to feature; MODIFIER	silent_mutation	Average:58.458; most accessible tissue: Callus, score: 77.129	N	N	N	N
vg1102375085	T -> A	LOC_Os11g05340-LOC_Os11g05350	intergenic_region ; MODIFIER	silent_mutation	Average:58.458; most accessible tissue: Callus, score: 77.129	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1102375085	NA	4.96E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	3.79E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	9.21E-07	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	8.87E-06	mr1677	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	6.15E-07	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	1.05E-06	mr1835	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	5.92E-14	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	8.88E-07	6.18E-13	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	2.11E-09	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	2.40E-07	mr1942	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	4.79E-09	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	4.35E-11	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	1.04E-10	mr1265_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	3.30E-10	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	7.05E-09	mr1528_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	1.92E-07	mr1558_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	3.56E-10	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	3.20E-06	mr1735_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	3.51E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	2.59E-10	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	3.57E-09	mr1835_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	1.11E-06	mr1838_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	1.99E-13	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085	NA	7.43E-10	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251