Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102375085:

Variant ID: vg1102375085 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 2375085
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.02, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


GGTAATTTTTTTATGTGTTCACTTAAAAAAACATAAAAAAAAAGAAACTACGTTCGAAATACCTTAAAATCAAATCTAAAATTTAGTTTTAAAATTCAAT[T/A]
TTTAGCAGCGACGTGTTGTTCATGAATGGGTTGCAGGAATGATCTGGGGGGCATTGGTAGATTGAAAGTGGGATGGCAATCACATGTTCATACGATAAGA

Reverse complement sequence

TCTTATCGTATGAACATGTGATTGCCATCCCACTTTCAATCTACCAATGCCCCCCAGATCATTCCTGCAACCCATTCATGAACAACACGTCGCTGCTAAA[A/T]
ATTGAATTTTAAAACTAAATTTTAGATTTGATTTTAAGGTATTTCGAACGTAGTTTCTTTTTTTTTATGTTTTTTTAAGTGAACACATAAAAAAATTACC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.90% 17.10% 0.02% 0.00% NA
All Indica  2759 77.40% 22.60% 0.00% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 62.10% 37.90% 0.00% 0.00% NA
Indica I  595 21.20% 78.80% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 98.10% 1.90% 0.00% 0.00% NA
Indica Intermediate  786 83.80% 16.20% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 4.10% 0.00% 0.00% NA
VI/Aromatic  96 38.50% 60.40% 1.04% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1102375085 T -> A LOC_Os11g05340.1 upstream_gene_variant ; 2949.0bp to feature; MODIFIER silent_mutation Average:58.458; most accessible tissue: Callus, score: 77.129 N N N N
vg1102375085 T -> A LOC_Os11g05360.1 upstream_gene_variant ; 4054.0bp to feature; MODIFIER silent_mutation Average:58.458; most accessible tissue: Callus, score: 77.129 N N N N
vg1102375085 T -> A LOC_Os11g05350.1 downstream_gene_variant ; 924.0bp to feature; MODIFIER silent_mutation Average:58.458; most accessible tissue: Callus, score: 77.129 N N N N
vg1102375085 T -> A LOC_Os11g05340-LOC_Os11g05350 intergenic_region ; MODIFIER silent_mutation Average:58.458; most accessible tissue: Callus, score: 77.129 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1102375085 NA 4.96E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 3.79E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 9.21E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 8.87E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 6.15E-07 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 1.05E-06 mr1835 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 5.92E-14 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 8.88E-07 6.18E-13 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 2.11E-09 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 2.40E-07 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 4.79E-09 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 4.35E-11 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 1.04E-10 mr1265_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 3.30E-10 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 7.05E-09 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 1.92E-07 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 3.56E-10 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 3.20E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 3.51E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 2.59E-10 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 3.57E-09 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 1.11E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 1.99E-13 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102375085 NA 7.43E-10 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251