Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102329689:

Variant ID: vg1102329689 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 2329689
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

ATGGAGCATTAAATGTGGACGAAAAAAAATTGCACAATTTGCATGTAAATTGCGAGACGAATCTTTTAAGCCTAATTACGCCATAATTTGATAATATGGT[G/A]
CTACAGTAAACATTTGCTATGACGGATTAATTAGGTTTAATAGATTCGTCTCGCAGTTTACAGACGAAATCTATAATCTGTTTTATTATTTGTCTACATT

Reverse complement sequence

AATGTAGACAAATAATAAAACAGATTATAGATTTCGTCTGTAAACTGCGAGACGAATCTATTAAACCTAATTAATCCGTCATAGCAAATGTTTACTGTAG[C/T]
ACCATATTATCAAATTATGGCGTAATTAGGCTTAAAAGATTCGTCTCGCAATTTACATGCAAATTGTGCAATTTTTTTTCGTCCACATTTAATGCTCCAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.60%	16.40%	0.00%	0.00%	NA
All Indica	2759	76.60%	23.40%	0.00%	0.00%	NA
All Japonica	1512	99.40%	0.60%	0.00%	0.00%	NA
Aus	269	59.50%	40.50%	0.00%	0.00%	NA
Indica I	595	21.70%	78.30%	0.00%	0.00%	NA
Indica II	465	97.00%	3.00%	0.00%	0.00%	NA
Indica III	913	97.40%	2.60%	0.00%	0.00%	NA
Indica Intermediate	786	81.90%	18.10%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1102329689	G -> A	LOC_Os11g05260.1	upstream_gene_variant ; 269.0bp to feature; MODIFIER	silent_mutation	Average:72.284; most accessible tissue: Callus, score: 91.357	N	N	N	N
vg1102329689	G -> A	LOC_Os11g05250.1	downstream_gene_variant ; 2172.0bp to feature; MODIFIER	silent_mutation	Average:72.284; most accessible tissue: Callus, score: 91.357	N	N	N	N
vg1102329689	G -> A	LOC_Os11g05250-LOC_Os11g05260	intergenic_region ; MODIFIER	silent_mutation	Average:72.284; most accessible tissue: Callus, score: 91.357	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1102329689	NA	1.73E-06	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	2.49E-06	mr1686	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	3.49E-07	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	3.81E-07	mr1835	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	6.00E-07	2.62E-17	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	2.02E-10	1.27E-16	mr1904	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	4.30E-08	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	2.41E-07	mr1942	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	1.98E-08	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	3.21E-07	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	2.45E-09	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	6.03E-09	mr1265_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	8.85E-06	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	3.36E-10	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	1.22E-08	mr1528_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	4.34E-06	mr1558_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	1.05E-09	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	2.91E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	2.68E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	2.44E-10	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	1.15E-08	mr1835_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	2.75E-06	mr1838_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	1.17E-06	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	9.88E-14	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102329689	NA	8.18E-10	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251