\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102284530:

Variant ID: vg1102284530 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 2284530
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, A: 0.28, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TAGAGTGATTGGGAAGATAGCTCATGATTAATTGAGTATTAACTATTTTAAATTTCAAAAATGGATTAATATGATTTTTTAAAGCAACTTTCCTATAGAA[T/A]
TTTTTTGCAAAAAATACATCGTTTAGTAGTTTGAAAAACGTGCGCGCGAAAAACGAGACTCAATCTCCCCTATCTCGCCAGAACGAACATAGCCTAAATA

Reverse complement sequence

TATTTAGGCTATGTTCGTTCTGGCGAGATAGGGGAGATTGAGTCTCGTTTTTCGCGCGCACGTTTTTCAAACTACTAAACGATGTATTTTTTGCAAAAAA[A/T]
TTCTATAGGAAAGTTGCTTTAAAAAATCATATTAATCCATTTTTGAAATTTAAAATAGTTAATACTCAATTAATCATGAGCTATCTTCCCAATCACTCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 39.90% 0.19% 0.00% NA
All Indica  2759 89.50% 10.30% 0.25% 0.00% NA
All Japonica  1512 2.60% 97.40% 0.00% 0.00% NA
Aus  269 82.20% 17.50% 0.37% 0.00% NA
Indica I  595 96.60% 3.20% 0.17% 0.00% NA
Indica II  465 96.80% 3.00% 0.22% 0.00% NA
Indica III  913 86.00% 13.90% 0.11% 0.00% NA
Indica Intermediate  786 83.80% 15.60% 0.51% 0.00% NA
Temperate Japonica  767 2.50% 97.50% 0.00% 0.00% NA
Tropical Japonica  504 1.60% 98.40% 0.00% 0.00% NA
Japonica Intermediate  241 5.40% 94.60% 0.00% 0.00% NA
VI/Aromatic  96 58.30% 40.60% 1.04% 0.00% NA
Intermediate  90 47.80% 52.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1102284530 T -> A LOC_Os11g05180.1 downstream_gene_variant ; 4961.0bp to feature; MODIFIER silent_mutation Average:49.276; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg1102284530 T -> A LOC_Os11g05180.2 downstream_gene_variant ; 2915.0bp to feature; MODIFIER silent_mutation Average:49.276; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg1102284530 T -> A LOC_Os11g05180.3 downstream_gene_variant ; 2915.0bp to feature; MODIFIER silent_mutation Average:49.276; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg1102284530 T -> A LOC_Os11g05180-LOC_Os11g05190 intergenic_region ; MODIFIER silent_mutation Average:49.276; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1102284530 NA 6.14E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102284530 NA 8.26E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102284530 NA 1.87E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102284530 NA 4.91E-12 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102284530 2.26E-06 2.26E-06 mr1985 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251