\
| Variant ID: vg1102284530 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 2284530 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, A: 0.28, others allele: 0.00, population size: 82. )
TAGAGTGATTGGGAAGATAGCTCATGATTAATTGAGTATTAACTATTTTAAATTTCAAAAATGGATTAATATGATTTTTTAAAGCAACTTTCCTATAGAA[T/A]
TTTTTTGCAAAAAATACATCGTTTAGTAGTTTGAAAAACGTGCGCGCGAAAAACGAGACTCAATCTCCCCTATCTCGCCAGAACGAACATAGCCTAAATA
TATTTAGGCTATGTTCGTTCTGGCGAGATAGGGGAGATTGAGTCTCGTTTTTCGCGCGCACGTTTTTCAAACTACTAAACGATGTATTTTTTGCAAAAAA[A/T]
TTCTATAGGAAAGTTGCTTTAAAAAATCATATTAATCCATTTTTGAAATTTAAAATAGTTAATACTCAATTAATCATGAGCTATCTTCCCAATCACTCTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.90% | 39.90% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 89.50% | 10.30% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 82.20% | 17.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 96.60% | 3.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 86.00% | 13.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 83.80% | 15.60% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.40% | 94.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 58.30% | 40.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 52.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1102284530 | T -> A | LOC_Os11g05180.1 | downstream_gene_variant ; 4961.0bp to feature; MODIFIER | silent_mutation | Average:49.276; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg1102284530 | T -> A | LOC_Os11g05180.2 | downstream_gene_variant ; 2915.0bp to feature; MODIFIER | silent_mutation | Average:49.276; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg1102284530 | T -> A | LOC_Os11g05180.3 | downstream_gene_variant ; 2915.0bp to feature; MODIFIER | silent_mutation | Average:49.276; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg1102284530 | T -> A | LOC_Os11g05180-LOC_Os11g05190 | intergenic_region ; MODIFIER | silent_mutation | Average:49.276; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1102284530 | NA | 6.14E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102284530 | NA | 8.26E-06 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102284530 | NA | 1.87E-07 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102284530 | NA | 4.91E-12 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102284530 | 2.26E-06 | 2.26E-06 | mr1985 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |