Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102284530:

Variant ID: vg1102284530 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 2284530
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, A: 0.28, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

TAGAGTGATTGGGAAGATAGCTCATGATTAATTGAGTATTAACTATTTTAAATTTCAAAAATGGATTAATATGATTTTTTAAAGCAACTTTCCTATAGAA[T/A]
TTTTTTGCAAAAAATACATCGTTTAGTAGTTTGAAAAACGTGCGCGCGAAAAACGAGACTCAATCTCCCCTATCTCGCCAGAACGAACATAGCCTAAATA

Reverse complement sequence

TATTTAGGCTATGTTCGTTCTGGCGAGATAGGGGAGATTGAGTCTCGTTTTTCGCGCGCACGTTTTTCAAACTACTAAACGATGTATTTTTTGCAAAAAA[A/T]
TTCTATAGGAAAGTTGCTTTAAAAAATCATATTAATCCATTTTTGAAATTTAAAATAGTTAATACTCAATTAATCATGAGCTATCTTCCCAATCACTCTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.90%	39.90%	0.19%	0.00%	NA
All Indica	2759	89.50%	10.30%	0.25%	0.00%	NA
All Japonica	1512	2.60%	97.40%	0.00%	0.00%	NA
Aus	269	82.20%	17.50%	0.37%	0.00%	NA
Indica I	595	96.60%	3.20%	0.17%	0.00%	NA
Indica II	465	96.80%	3.00%	0.22%	0.00%	NA
Indica III	913	86.00%	13.90%	0.11%	0.00%	NA
Indica Intermediate	786	83.80%	15.60%	0.51%	0.00%	NA
Temperate Japonica	767	2.50%	97.50%	0.00%	0.00%	NA
Tropical Japonica	504	1.60%	98.40%	0.00%	0.00%	NA
Japonica Intermediate	241	5.40%	94.60%	0.00%	0.00%	NA
VI/Aromatic	96	58.30%	40.60%	1.04%	0.00%	NA
Intermediate	90	47.80%	52.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1102284530	T -> A	LOC_Os11g05180.1	downstream_gene_variant ; 4961.0bp to feature; MODIFIER	silent_mutation	Average:49.276; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg1102284530	T -> A	LOC_Os11g05180.2	downstream_gene_variant ; 2915.0bp to feature; MODIFIER	silent_mutation	Average:49.276; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg1102284530	T -> A	LOC_Os11g05180.3	downstream_gene_variant ; 2915.0bp to feature; MODIFIER	silent_mutation	Average:49.276; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg1102284530	T -> A	LOC_Os11g05180-LOC_Os11g05190	intergenic_region ; MODIFIER	silent_mutation	Average:49.276; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1102284530	NA	6.14E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102284530	NA	8.26E-06	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102284530	NA	1.87E-07	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102284530	NA	4.91E-12	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102284530	2.26E-06	2.26E-06	mr1985	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251