\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102274880:

Variant ID: vg1102274880 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 2274880
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTGATAAGTTTATTTTGGCTATAATCTGAACAGCCCCCGAGTTTGTATCAGTCTTTAGGTCGCTGAGGATATCTCGGATCATGAGTAATGAAATTTCT[G/A]
GTTTGCCTAAAAGAAAAAATATATTTCCGGATCAATGTGTTGACTTGCCGTCAAACCTTGCAACGGGCTCATACGATCGAGGATAGGCTATACGAGTCCA

Reverse complement sequence

TGGACTCGTATAGCCTATCCTCGATCGTATGAGCCCGTTGCAAGGTTTGACGGCAAGTCAACACATTGATCCGGAAATATATTTTTTCTTTTAGGCAAAC[C/T]
AGAAATTTCATTACTCATGATCCGAGATATCCTCAGCGACCTAAAGACTGATACAAACTCGGGGGCTGTTCAGATTATAGCCAAAATAAACTTATCAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.00% 3.20% 3.81% 0.00% NA
All Indica  2759 88.30% 5.40% 6.23% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 97.00% 0.00% 2.97% 0.00% NA
Indica I  595 52.60% 22.70% 24.71% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 95.20% 1.80% 3.05% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1102274880 G -> A LOC_Os11g05170.1 upstream_gene_variant ; 1507.0bp to feature; MODIFIER silent_mutation Average:60.184; most accessible tissue: Callus, score: 84.561 N N N N
vg1102274880 G -> A LOC_Os11g05180.1 upstream_gene_variant ; 3839.0bp to feature; MODIFIER silent_mutation Average:60.184; most accessible tissue: Callus, score: 84.561 N N N N
vg1102274880 G -> A LOC_Os11g05180.2 upstream_gene_variant ; 3857.0bp to feature; MODIFIER silent_mutation Average:60.184; most accessible tissue: Callus, score: 84.561 N N N N
vg1102274880 G -> A LOC_Os11g05180.3 upstream_gene_variant ; 3868.0bp to feature; MODIFIER silent_mutation Average:60.184; most accessible tissue: Callus, score: 84.561 N N N N
vg1102274880 G -> A LOC_Os11g05160.1 downstream_gene_variant ; 797.0bp to feature; MODIFIER silent_mutation Average:60.184; most accessible tissue: Callus, score: 84.561 N N N N
vg1102274880 G -> A LOC_Os11g05160-LOC_Os11g05170 intergenic_region ; MODIFIER silent_mutation Average:60.184; most accessible tissue: Callus, score: 84.561 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1102274880 NA 1.89E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102274880 NA 9.47E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102274880 NA 3.83E-06 mr1502_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102274880 NA 1.04E-08 mr1543_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102274880 NA 7.81E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102274880 NA 6.19E-07 mr1742_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102274880 NA 2.83E-10 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102274880 NA 1.08E-08 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102274880 NA 1.74E-08 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251