\
| Variant ID: vg1102274880 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 2274880 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 295. )
ATTTGATAAGTTTATTTTGGCTATAATCTGAACAGCCCCCGAGTTTGTATCAGTCTTTAGGTCGCTGAGGATATCTCGGATCATGAGTAATGAAATTTCT[G/A]
GTTTGCCTAAAAGAAAAAATATATTTCCGGATCAATGTGTTGACTTGCCGTCAAACCTTGCAACGGGCTCATACGATCGAGGATAGGCTATACGAGTCCA
TGGACTCGTATAGCCTATCCTCGATCGTATGAGCCCGTTGCAAGGTTTGACGGCAAGTCAACACATTGATCCGGAAATATATTTTTTCTTTTAGGCAAAC[C/T]
AGAAATTTCATTACTCATGATCCGAGATATCCTCAGCGACCTAAAGACTGATACAAACTCGGGGGCTGTTCAGATTATAGCCAAAATAAACTTATCAAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.00% | 3.20% | 3.81% | 0.00% | NA |
| All Indica | 2759 | 88.30% | 5.40% | 6.23% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.00% | 0.00% | 2.97% | 0.00% | NA |
| Indica I | 595 | 52.60% | 22.70% | 24.71% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.20% | 1.80% | 3.05% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1102274880 | G -> A | LOC_Os11g05170.1 | upstream_gene_variant ; 1507.0bp to feature; MODIFIER | silent_mutation | Average:60.184; most accessible tissue: Callus, score: 84.561 | N | N | N | N |
| vg1102274880 | G -> A | LOC_Os11g05180.1 | upstream_gene_variant ; 3839.0bp to feature; MODIFIER | silent_mutation | Average:60.184; most accessible tissue: Callus, score: 84.561 | N | N | N | N |
| vg1102274880 | G -> A | LOC_Os11g05180.2 | upstream_gene_variant ; 3857.0bp to feature; MODIFIER | silent_mutation | Average:60.184; most accessible tissue: Callus, score: 84.561 | N | N | N | N |
| vg1102274880 | G -> A | LOC_Os11g05180.3 | upstream_gene_variant ; 3868.0bp to feature; MODIFIER | silent_mutation | Average:60.184; most accessible tissue: Callus, score: 84.561 | N | N | N | N |
| vg1102274880 | G -> A | LOC_Os11g05160.1 | downstream_gene_variant ; 797.0bp to feature; MODIFIER | silent_mutation | Average:60.184; most accessible tissue: Callus, score: 84.561 | N | N | N | N |
| vg1102274880 | G -> A | LOC_Os11g05160-LOC_Os11g05170 | intergenic_region ; MODIFIER | silent_mutation | Average:60.184; most accessible tissue: Callus, score: 84.561 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1102274880 | NA | 1.89E-07 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102274880 | NA | 9.47E-06 | mr1291_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102274880 | NA | 3.83E-06 | mr1502_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102274880 | NA | 1.04E-08 | mr1543_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102274880 | NA | 7.81E-06 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102274880 | NA | 6.19E-07 | mr1742_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102274880 | NA | 2.83E-10 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102274880 | NA | 1.08E-08 | mr1835_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102274880 | NA | 1.74E-08 | mr1904_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |