\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102224382:

Variant ID: vg1102224382 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 2224382
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, C: 0.38, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TAGAAAAAACAAATGAATAACCGTTTGGTTGGACCGAAAGAAATACATATGAATTTGAAGAGGGATAAAGACTTAAAGAAAACTTTCTCAGGTTCTACAT[T/C]
ATGTTAAATTTTCTATAAAACTTGCATGGAATGAAATATTACATAGGAATTACATAGGACTATATGATTCATTCCTTTAACTTTAAGGGCTATATAGAAA

Reverse complement sequence

TTTCTATATAGCCCTTAAAGTTAAAGGAATGAATCATATAGTCCTATGTAATTCCTATGTAATATTTCATTCCATGCAAGTTTTATAGAAAATTTAACAT[A/G]
ATGTAGAACCTGAGAAAGTTTTCTTTAAGTCTTTATCCCTCTTCAAATTCATATGTATTTCTTTCGGTCCAACCAAACGGTTATTCATTTGTTTTTTCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.90% 38.90% 0.17% 0.00% NA
All Indica  2759 91.30% 8.50% 0.14% 0.00% NA
All Japonica  1512 2.60% 97.30% 0.07% 0.00% NA
Aus  269 82.20% 17.80% 0.00% 0.00% NA
Indica I  595 97.30% 2.70% 0.00% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 87.30% 12.50% 0.22% 0.00% NA
Indica Intermediate  786 88.30% 11.50% 0.25% 0.00% NA
Temperate Japonica  767 2.50% 97.40% 0.13% 0.00% NA
Tropical Japonica  504 1.60% 98.40% 0.00% 0.00% NA
Japonica Intermediate  241 5.40% 94.60% 0.00% 0.00% NA
VI/Aromatic  96 59.40% 38.50% 2.08% 0.00% NA
Intermediate  90 45.60% 53.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1102224382 T -> C LOC_Os11g05070.1 upstream_gene_variant ; 3634.0bp to feature; MODIFIER silent_mutation Average:55.838; most accessible tissue: Zhenshan97 flower, score: 84.409 N N N N
vg1102224382 T -> C LOC_Os11g05080.1 upstream_gene_variant ; 366.0bp to feature; MODIFIER silent_mutation Average:55.838; most accessible tissue: Zhenshan97 flower, score: 84.409 N N N N
vg1102224382 T -> C LOC_Os11g05070-LOC_Os11g05080 intergenic_region ; MODIFIER silent_mutation Average:55.838; most accessible tissue: Zhenshan97 flower, score: 84.409 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1102224382 NA 2.48E-06 mr1168 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102224382 8.65E-07 2.53E-06 mr1310 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102224382 NA 7.61E-12 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102224382 NA 1.33E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251