\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102153486:

Variant ID: vg1102153486 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 2153486
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCCCTCCTTACCAAGGCCCAAAACCCACCTCCCACCTCGGTTAAAGGCCCCTCCCACCGGTCAAACCCGCCTACTAACTCCCCCCACCACCCACCTCTT[C/A]
TCAGCTCTCGTCCCAGGACGGTGCAGTAACACGACGACCTCTATGCAGTAACACTGTGTCTTACTTGCAGTAACAGCGTTAAAATATAGTTGAAATATAG

Reverse complement sequence

CTATATTTCAACTATATTTTAACGCTGTTACTGCAAGTAAGACACAGTGTTACTGCATAGAGGTCGTCGTGTTACTGCACCGTCCTGGGACGAGAGCTGA[G/T]
AAGAGGTGGGTGGTGGGGGGAGTTAGTAGGCGGGTTTGACCGGTGGGAGGGGCCTTTAACCGAGGTGGGAGGTGGGTTTTGGGCCTTGGTAAGGAGGGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.30% 17.50% 0.21% 0.00% NA
All Indica  2759 76.40% 23.50% 0.14% 0.00% NA
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 41.60% 56.50% 1.86% 0.00% NA
Indica I  595 22.70% 77.10% 0.17% 0.00% NA
Indica II  465 95.50% 4.50% 0.00% 0.00% NA
Indica III  913 98.00% 1.90% 0.11% 0.00% NA
Indica Intermediate  786 80.50% 19.20% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 87.80% 11.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1102153486 C -> A LOC_Os11g05000.1 downstream_gene_variant ; 1175.0bp to feature; MODIFIER silent_mutation Average:52.571; most accessible tissue: Minghui63 root, score: 71.259 N N N N
vg1102153486 C -> A LOC_Os11g04990-LOC_Os11g05000 intergenic_region ; MODIFIER silent_mutation Average:52.571; most accessible tissue: Minghui63 root, score: 71.259 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1102153486 NA 3.14E-07 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153486 NA 1.26E-14 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153486 NA 4.04E-10 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153486 NA 9.75E-08 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153486 NA 1.94E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153486 NA 1.28E-07 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153486 NA 2.55E-08 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153486 NA 7.28E-09 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153486 NA 1.56E-06 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153486 3.96E-06 4.70E-11 mr1528_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153486 NA 8.10E-09 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153486 NA 2.69E-09 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153486 NA 1.13E-07 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153486 NA 4.49E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153486 NA 7.32E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153486 NA 5.46E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153486 NA 1.81E-06 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153486 NA 2.11E-07 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153486 NA 4.79E-06 mr1876_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153486 NA 2.23E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251