Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102153284:

Variant ID: vg1102153284 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 2153284
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.01, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGCAAATAAAGTTTAGATCCAAGTCAAAGAAAAGATCAAAAGTGAGATTACTCAAAGGAAGAATCGAGAAGAGCATGACTTGAAATATTTTGCAAAAA[T/A]
TTTTCCCTGAAAATTTGAGTCCGTTACACACACACACATATATATAGAAAAACTATTCTTCCGGGTATAGAACAGCCTCCCTCCCAAGGGTCACACCCAC

Reverse complement sequence

GTGGGTGTGACCCTTGGGAGGGAGGCTGTTCTATACCCGGAAGAATAGTTTTTCTATATATATGTGTGTGTGTGTAACGGACTCAAATTTTCAGGGAAAA[A/T]
TTTTTGCAAAATATTTCAAGTCATGCTCTTCTCGATTCTTCCTTTGAGTAATCTCACTTTTGATCTTTTCTTTGACTTGGATCTAAACTTTATTTGCTAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.20%	14.10%	2.71%	0.00%	NA
All Indica	2759	77.00%	20.60%	2.43%	0.00%	NA
All Japonica	1512	99.30%	0.50%	0.13%	0.00%	NA
Aus	269	51.30%	29.40%	19.33%	0.00%	NA
Indica I	595	22.90%	68.90%	8.24%	0.00%	NA
Indica II	465	95.30%	3.70%	1.08%	0.00%	NA
Indica III	913	98.40%	1.60%	0.00%	0.00%	NA
Indica Intermediate	786	82.30%	16.00%	1.65%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	1.70%	0.83%	0.00%	NA
VI/Aromatic	96	90.60%	4.20%	5.21%	0.00%	NA
Intermediate	90	88.90%	8.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1102153284	T -> A	LOC_Os11g05000.1	downstream_gene_variant ; 1377.0bp to feature; MODIFIER	silent_mutation	Average:46.563; most accessible tissue: Minghui63 root, score: 70.332	N	N	N	N
vg1102153284	T -> A	LOC_Os11g04990-LOC_Os11g05000	intergenic_region ; MODIFIER	silent_mutation	Average:46.563; most accessible tissue: Minghui63 root, score: 70.332	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1102153284	NA	5.59E-08	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	NA	1.56E-06	mr1835	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	3.38E-09	2.97E-21	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	2.03E-09	1.44E-15	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	NA	1.69E-06	mr1942	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	NA	7.48E-09	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	NA	1.53E-07	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	NA	9.47E-08	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	NA	7.52E-09	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	NA	1.29E-09	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	NA	2.76E-10	mr1265_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	NA	9.54E-07	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	NA	5.35E-10	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	NA	7.62E-10	mr1528_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	NA	1.83E-07	mr1558_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	NA	1.22E-11	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	NA	1.69E-07	mr1593_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	NA	7.37E-11	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	NA	5.79E-06	mr1659_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	NA	7.14E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	8.71E-07	1.87E-16	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	4.28E-06	3.10E-10	mr1835_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	NA	1.75E-07	mr1838_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	7.29E-06	5.05E-20	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102153284	NA	1.00E-10	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251