Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1102149285:

Variant ID: vg1102149285 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 2149285
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.29, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

TAATAAAAACCATAAATCATCTTTATCCTCAACTCTTTAATTTTAAAACTACTTATACTTCAGGAGTAGGAATCACCCTGATGACACAACTGCAGAACCG[G/A]
GAGTATGGCACATTCGAATGATTTAATTCACCTCTGCAGAGACTGTCCAGCTTTACCCACACGATGTCAACAATTTGCAAGGCTAAGGACACCAGAGCCG

Reverse complement sequence

CGGCTCTGGTGTCCTTAGCCTTGCAAATTGTTGACATCGTGTGGGTAAAGCTGGACAGTCTCTGCAGAGGTGAATTAAATCATTCGAATGTGCCATACTC[C/T]
CGGTTCTGCAGTTGTGTCATCAGGGTGATTCCTACTCCTGAAGTATAAGTAGTTTTAAAATTAAAGAGTTGAGGATAAAGATGATTTATGGTTTTTATTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.20%	34.30%	0.36%	2.09%	NA
All Indica	2759	93.60%	2.20%	0.58%	3.59%	NA
All Japonica	1512	3.20%	96.80%	0.00%	0.00%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	95.00%	1.20%	1.18%	2.69%	NA
Indica II	465	90.30%	2.40%	0.86%	6.45%	NA
Indica III	913	95.40%	0.70%	0.22%	3.72%	NA
Indica Intermediate	786	92.50%	4.70%	0.38%	2.42%	NA
Temperate Japonica	767	2.70%	97.30%	0.00%	0.00%	NA
Tropical Japonica	504	2.80%	97.20%	0.00%	0.00%	NA
Japonica Intermediate	241	5.40%	94.60%	0.00%	0.00%	NA
VI/Aromatic	96	60.40%	39.60%	0.00%	0.00%	NA
Intermediate	90	45.60%	53.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1102149285	G -> A	LOC_Os11g04990.1	downstream_gene_variant ; 1171.0bp to feature; MODIFIER	silent_mutation	Average:53.41; most accessible tissue: Zhenshan97 root, score: 70.636	N	N	N	N
vg1102149285	G -> A	LOC_Os11g04990.2	downstream_gene_variant ; 2524.0bp to feature; MODIFIER	silent_mutation	Average:53.41; most accessible tissue: Zhenshan97 root, score: 70.636	N	N	N	N
vg1102149285	G -> A	LOC_Os11g04990-LOC_Os11g05000	intergenic_region ; MODIFIER	silent_mutation	Average:53.41; most accessible tissue: Zhenshan97 root, score: 70.636	N	N	N	N
vg1102149285	G -> DEL	N	N	silent_mutation	Average:53.41; most accessible tissue: Zhenshan97 root, score: 70.636	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1102149285	NA	1.00E-06	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102149285	NA	5.73E-23	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102149285	NA	2.81E-35	mr1181_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102149285	NA	6.49E-26	mr1653_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102149285	NA	4.24E-08	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102149285	NA	1.20E-32	mr1723_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102149285	NA	5.41E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102149285	NA	6.41E-14	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251