\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102103286:

Variant ID: vg1102103286 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 2103286
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 46. )

Flanking Sequence (100 bp) in Reference Genome:


AGGTGGAGTAGCAACGAGGAGGAGGTGGACACCCGAAGGGAGGAAAGCAGTGGGGAGGTGGAGTAGCAACGAGGAGGGCTAGGACGCAGCCAGTTGATGC[C/T]
GGCAGAGGAGCCACTCGGCGCCGAAGCACCAGCAGAGGAAGACAAGGGATTCGCTGCTGCCTCTGACCCCTTTGCCGCCGGGAACTGAAGAAGAGAATAA

Reverse complement sequence

TTATTCTCTTCTTCAGTTCCCGGCGGCAAAGGGGTCAGAGGCAGCAGCGAATCCCTTGTCTTCCTCTGCTGGTGCTTCGGCGCCGAGTGGCTCCTCTGCC[G/A]
GCATCAACTGGCTGCGTCCTAGCCCTCCTCGTTGCTACTCCACCTCCCCACTGCTTTCCTCCCTTCGGGTGTCCACCTCCTCCTCGTTGCTACTCCACCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.10% 18.30% 0.61% 43.99% NA
All Indica  2759 3.80% 24.70% 0.91% 70.53% NA
All Japonica  1512 97.20% 0.60% 0.00% 2.18% NA
Aus  269 14.50% 58.40% 1.12% 26.02% NA
Indica I  595 2.50% 79.30% 0.17% 17.98% NA
Indica II  465 3.70% 4.70% 1.94% 89.68% NA
Indica III  913 2.50% 2.20% 0.55% 94.74% NA
Indica Intermediate  786 6.50% 21.40% 1.27% 70.87% NA
Temperate Japonica  767 97.40% 0.00% 0.00% 2.61% NA
Tropical Japonica  504 97.20% 0.60% 0.00% 2.18% NA
Japonica Intermediate  241 96.70% 2.50% 0.00% 0.83% NA
VI/Aromatic  96 85.40% 8.30% 1.04% 5.21% NA
Intermediate  90 61.10% 11.10% 0.00% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1102103286 C -> T LOC_Os11g04930.1 upstream_gene_variant ; 563.0bp to feature; MODIFIER silent_mutation Average:14.235; most accessible tissue: Callus, score: 82.962 N N N N
vg1102103286 C -> T LOC_Os11g04920.1 downstream_gene_variant ; 2386.0bp to feature; MODIFIER silent_mutation Average:14.235; most accessible tissue: Callus, score: 82.962 N N N N
vg1102103286 C -> T LOC_Os11g04935.1 downstream_gene_variant ; 4295.0bp to feature; MODIFIER silent_mutation Average:14.235; most accessible tissue: Callus, score: 82.962 N N N N
vg1102103286 C -> T LOC_Os11g04920-LOC_Os11g04930 intergenic_region ; MODIFIER silent_mutation Average:14.235; most accessible tissue: Callus, score: 82.962 N N N N
vg1102103286 C -> DEL N N silent_mutation Average:14.235; most accessible tissue: Callus, score: 82.962 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1102103286 NA 1.95E-06 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 NA 2.99E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 NA 1.25E-06 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 NA 4.28E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 NA 4.25E-10 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 1.29E-06 1.61E-13 mr1835 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 4.80E-07 2.46E-10 mr1835 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 1.28E-07 5.11E-21 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 2.39E-06 2.68E-12 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 NA 3.48E-06 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 NA 1.63E-07 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 NA 9.26E-08 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 NA 4.07E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 NA 7.75E-08 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 NA 1.48E-07 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 NA 9.10E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 NA 3.20E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 NA 7.27E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 NA 1.16E-11 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 NA 7.01E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 NA 1.09E-11 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 NA 3.41E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 NA 3.13E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 NA 3.43E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 NA 5.30E-09 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 1.72E-06 4.45E-16 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 6.41E-06 4.85E-09 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 NA 7.51E-07 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 2.61E-07 1.23E-23 mr1904_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286 1.05E-06 1.98E-13 mr1904_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251