Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102103286:

Variant ID: vg1102103286 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 2103286
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 46. )

Flanking Sequence (100 bp) in Reference Genome:

AGGTGGAGTAGCAACGAGGAGGAGGTGGACACCCGAAGGGAGGAAAGCAGTGGGGAGGTGGAGTAGCAACGAGGAGGGCTAGGACGCAGCCAGTTGATGC[C/T]
GGCAGAGGAGCCACTCGGCGCCGAAGCACCAGCAGAGGAAGACAAGGGATTCGCTGCTGCCTCTGACCCCTTTGCCGCCGGGAACTGAAGAAGAGAATAA

Reverse complement sequence

TTATTCTCTTCTTCAGTTCCCGGCGGCAAAGGGGTCAGAGGCAGCAGCGAATCCCTTGTCTTCCTCTGCTGGTGCTTCGGCGCCGAGTGGCTCCTCTGCC[G/A]
GCATCAACTGGCTGCGTCCTAGCCCTCCTCGTTGCTACTCCACCTCCCCACTGCTTTCCTCCCTTCGGGTGTCCACCTCCTCCTCGTTGCTACTCCACCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.10%	18.30%	0.61%	43.99%	NA
All Indica	2759	3.80%	24.70%	0.91%	70.53%	NA
All Japonica	1512	97.20%	0.60%	0.00%	2.18%	NA
Aus	269	14.50%	58.40%	1.12%	26.02%	NA
Indica I	595	2.50%	79.30%	0.17%	17.98%	NA
Indica II	465	3.70%	4.70%	1.94%	89.68%	NA
Indica III	913	2.50%	2.20%	0.55%	94.74%	NA
Indica Intermediate	786	6.50%	21.40%	1.27%	70.87%	NA
Temperate Japonica	767	97.40%	0.00%	0.00%	2.61%	NA
Tropical Japonica	504	97.20%	0.60%	0.00%	2.18%	NA
Japonica Intermediate	241	96.70%	2.50%	0.00%	0.83%	NA
VI/Aromatic	96	85.40%	8.30%	1.04%	5.21%	NA
Intermediate	90	61.10%	11.10%	0.00%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1102103286	C -> T	LOC_Os11g04930.1	upstream_gene_variant ; 563.0bp to feature; MODIFIER	silent_mutation	Average:14.235; most accessible tissue: Callus, score: 82.962	N	N	N	N
vg1102103286	C -> T	LOC_Os11g04920.1	downstream_gene_variant ; 2386.0bp to feature; MODIFIER	silent_mutation	Average:14.235; most accessible tissue: Callus, score: 82.962	N	N	N	N
vg1102103286	C -> T	LOC_Os11g04935.1	downstream_gene_variant ; 4295.0bp to feature; MODIFIER	silent_mutation	Average:14.235; most accessible tissue: Callus, score: 82.962	N	N	N	N
vg1102103286	C -> T	LOC_Os11g04920-LOC_Os11g04930	intergenic_region ; MODIFIER	silent_mutation	Average:14.235; most accessible tissue: Callus, score: 82.962	N	N	N	N
vg1102103286	C -> DEL	N	N	silent_mutation	Average:14.235; most accessible tissue: Callus, score: 82.962	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1102103286	NA	1.95E-06	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	NA	2.99E-09	mr1399	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	NA	1.25E-06	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	NA	4.28E-08	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	NA	4.25E-10	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	1.29E-06	1.61E-13	mr1835	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	4.80E-07	2.46E-10	mr1835	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	1.28E-07	5.11E-21	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	2.39E-06	2.68E-12	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	NA	3.48E-06	mr1942	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	NA	1.63E-07	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	NA	9.26E-08	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	NA	4.07E-07	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	NA	7.75E-08	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	NA	1.48E-07	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	NA	9.10E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	NA	3.20E-09	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	NA	7.27E-06	mr1558_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	NA	1.16E-11	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	NA	7.01E-06	mr1611_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	NA	1.09E-11	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	NA	3.41E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	NA	3.13E-10	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	NA	3.43E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	NA	5.30E-09	mr1829_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	1.72E-06	4.45E-16	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	6.41E-06	4.85E-09	mr1835_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	NA	7.51E-07	mr1838_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	2.61E-07	1.23E-23	mr1904_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102103286	1.05E-06	1.98E-13	mr1904_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251