\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102086445:

Variant ID: vg1102086445 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 2086445
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TAGACACTAGCAAAAAAATGGCATGATCAAAGGAGGACTTGATGGTACTCAAGCTATTTGAAAAACTAAAAAGCTCTCTTGTCAGTACTAATTGTTTACT[G/T]
AATTAGGTAAGTACAGCTTACAGAAAAATCATGCTTAGTTAACTTCAGTTTGAATTGGCAAACAAAACTAATACTACCCCCACACAAATGAATCACACCT

Reverse complement sequence

AGGTGTGATTCATTTGTGTGGGGGTAGTATTAGTTTTGTTTGCCAATTCAAACTGAAGTTAACTAAGCATGATTTTTCTGTAAGCTGTACTTACCTAATT[C/A]
AGTAAACAATTAGTACTGACAAGAGAGCTTTTTAGTTTTTCAAATAGCTTGAGTACCATCAAGTCCTCCTTTGATCATGCCATTTTTTTGCTAGTGTCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 11.40% 3.87% 25.03% NA
All Indica  2759 35.10% 18.50% 6.20% 40.20% NA
All Japonica  1512 98.30% 0.40% 0.00% 1.26% NA
Aus  269 74.00% 7.10% 2.23% 16.73% NA
Indica I  595 84.90% 1.80% 3.70% 9.58% NA
Indica II  465 12.30% 14.00% 12.04% 61.72% NA
Indica III  913 13.90% 29.60% 4.49% 52.03% NA
Indica Intermediate  786 35.50% 21.00% 6.62% 36.90% NA
Temperate Japonica  767 98.40% 0.30% 0.00% 1.30% NA
Tropical Japonica  504 97.80% 0.80% 0.00% 1.39% NA
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.83% NA
VI/Aromatic  96 97.90% 0.00% 1.04% 1.04% NA
Intermediate  90 78.90% 5.60% 5.56% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1102086445 G -> T LOC_Os11g04894.1 downstream_gene_variant ; 652.0bp to feature; MODIFIER silent_mutation Average:28.595; most accessible tissue: Callus, score: 68.466 N N N N
vg1102086445 G -> T LOC_Os11g04900.1 downstream_gene_variant ; 1352.0bp to feature; MODIFIER silent_mutation Average:28.595; most accessible tissue: Callus, score: 68.466 N N N N
vg1102086445 G -> T LOC_Os11g04910.1 downstream_gene_variant ; 4579.0bp to feature; MODIFIER silent_mutation Average:28.595; most accessible tissue: Callus, score: 68.466 N N N N
vg1102086445 G -> T LOC_Os11g04890-LOC_Os11g04894 intergenic_region ; MODIFIER silent_mutation Average:28.595; most accessible tissue: Callus, score: 68.466 N N N N
vg1102086445 G -> DEL N N silent_mutation Average:28.595; most accessible tissue: Callus, score: 68.466 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1102086445 NA 5.21E-07 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102086445 1.26E-06 1.26E-06 mr1540 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102086445 NA 4.99E-06 mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102086445 NA 1.05E-07 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102086445 NA 4.72E-08 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102086445 NA 1.99E-06 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251