Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102074001:

Variant ID: vg1102074001 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 2074001
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AGCCTATGGCCGGCGCCTGCTCGGCGAGGGAGATGGGACGGCGATGGTGACAGGGATGGAGGGAAACGGGCGACTGAGGAGGTGGACGGGAGTCAATGGC[G/A]
TCAATTAGGATAATGATAAATTACGATAATACTCCTACATGAATTATTATCTCTGGATAAGTATACCCCACCACGTTTCTACTACCACTATACCACTAAG

Reverse complement sequence

CTTAGTGGTATAGTGGTAGTAGAAACGTGGTGGGGTATACTTATCCAGAGATAATAATTCATGTAGGAGTATTATCGTAATTTATCATTATCCTAATTGA[C/T]
GCCATTGACTCCCGTCCACCTCCTCAGTCGCCCGTTTCCCTCCATCCCTGTCACCATCGCCGTCCCATCTCCCTCGCCGAGCAGGCGCCGGCCATAGGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.10% 45.60% 0.11% 0.17% NA
All Indica  2759 26.40% 73.10% 0.18% 0.29% NA
All Japonica  1512 97.80% 2.20% 0.00% 0.00% NA
Aus  269 72.90% 27.10% 0.00% 0.00% NA
Indica I  595 80.30% 19.20% 0.17% 0.34% NA
Indica II  465 6.90% 93.10% 0.00% 0.00% NA
Indica III  913 3.10% 96.90% 0.00% 0.00% NA
Indica Intermediate  786 24.30% 74.40% 0.51% 0.76% NA
Temperate Japonica  767 97.30% 2.70% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1102074001 G -> A LOC_Os11g04860.1 upstream_gene_variant ; 4571.0bp to feature; MODIFIER silent_mutation Average:92.722; most accessible tissue: Minghui63 root, score: 97.277 N N N N
vg1102074001 G -> A LOC_Os11g04870.1 upstream_gene_variant ; 178.0bp to feature; MODIFIER silent_mutation Average:92.722; most accessible tissue: Minghui63 root, score: 97.277 N N N N
vg1102074001 G -> A LOC_Os11g04880.1 upstream_gene_variant ; 551.0bp to feature; MODIFIER silent_mutation Average:92.722; most accessible tissue: Minghui63 root, score: 97.277 N N N N
vg1102074001 G -> A LOC_Os11g04890.1 upstream_gene_variant ; 3563.0bp to feature; MODIFIER silent_mutation Average:92.722; most accessible tissue: Minghui63 root, score: 97.277 N N N N
vg1102074001 G -> A LOC_Os11g04870-LOC_Os11g04880 intergenic_region ; MODIFIER silent_mutation Average:92.722; most accessible tissue: Minghui63 root, score: 97.277 N N N N
vg1102074001 G -> DEL N N silent_mutation Average:92.722; most accessible tissue: Minghui63 root, score: 97.277 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1102074001 G A -0.07 -0.07 -0.06 -0.05 -0.06 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1102074001 NA 5.91E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102074001 NA 1.38E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102074001 NA 1.17E-06 mr1835 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102074001 5.99E-06 NA mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102074001 2.76E-08 6.39E-14 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102074001 NA 6.85E-06 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102074001 NA 9.29E-08 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102074001 NA 1.49E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102074001 NA 3.37E-08 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102074001 NA 4.20E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102074001 NA 3.77E-08 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102074001 NA 1.71E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102074001 NA 5.38E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102074001 NA 1.04E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102074001 NA 5.89E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102074001 NA 4.78E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102074001 NA 2.43E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102074001 5.59E-07 NA mr1835_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102074001 6.16E-07 7.94E-11 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102074001 NA 4.30E-15 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102074001 NA 4.76E-07 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102074001 NA 2.66E-10 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251