\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102069789:

Variant ID: vg1102069789 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 2069789
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCAGAGAGCAATAATGGAATGCATGTGATGTTAGCACTGACGTATATGTACTCACGTTCTATCACCCAAAAAAAAACTCCATCCGTTCTAAAATATAA[C/T]
TGTTTTTTTACTTTTACTAAAAATATCTATAAAAGAAATATGTTTAAATAAAAAGAGTTACATATTATGATTTTTTGTTTAAGGATAAATCTAGTAACAT

Reverse complement sequence

ATGTTACTAGATTTATCCTTAAACAAAAAATCATAATATGTAACTCTTTTTATTTAAACATATTTCTTTTATAGATATTTTTAGTAAAAGTAAAAAAACA[G/A]
TTATATTTTAGAACGGATGGAGTTTTTTTTTGGGTGATAGAACGTGAGTACATATACGTCAGTGCTAACATCACATGCATTCCATTATTGCTCTCTGCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.70% 34.80% 3.11% 22.39% NA
All Indica  2759 62.90% 2.60% 3.15% 31.32% NA
All Japonica  1512 2.20% 97.00% 0.26% 0.46% NA
Aus  269 27.10% 3.70% 13.01% 56.13% NA
Indica I  595 14.80% 2.40% 4.37% 78.49% NA
Indica II  465 90.10% 2.40% 1.72% 5.81% NA
Indica III  913 83.50% 1.40% 2.74% 12.38% NA
Indica Intermediate  786 59.30% 4.50% 3.56% 32.70% NA
Temperate Japonica  767 2.70% 97.30% 0.00% 0.00% NA
Tropical Japonica  504 2.20% 97.20% 0.20% 0.40% NA
Japonica Intermediate  241 0.80% 95.90% 1.24% 2.07% NA
VI/Aromatic  96 5.20% 50.00% 20.83% 23.96% NA
Intermediate  90 30.00% 54.40% 1.11% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1102069789 C -> T LOC_Os11g04850.1 upstream_gene_variant ; 3256.0bp to feature; MODIFIER silent_mutation Average:74.324; most accessible tissue: Minghui63 root, score: 96.149 N N N N
vg1102069789 C -> T LOC_Os11g04860.1 upstream_gene_variant ; 359.0bp to feature; MODIFIER silent_mutation Average:74.324; most accessible tissue: Minghui63 root, score: 96.149 N N N N
vg1102069789 C -> T LOC_Os11g04880.1 upstream_gene_variant ; 4763.0bp to feature; MODIFIER silent_mutation Average:74.324; most accessible tissue: Minghui63 root, score: 96.149 N N N N
vg1102069789 C -> T LOC_Os11g04850.2 upstream_gene_variant ; 3240.0bp to feature; MODIFIER silent_mutation Average:74.324; most accessible tissue: Minghui63 root, score: 96.149 N N N N
vg1102069789 C -> T LOC_Os11g04870.1 downstream_gene_variant ; 3273.0bp to feature; MODIFIER silent_mutation Average:74.324; most accessible tissue: Minghui63 root, score: 96.149 N N N N
vg1102069789 C -> T LOC_Os11g04860-LOC_Os11g04870 intergenic_region ; MODIFIER silent_mutation Average:74.324; most accessible tissue: Minghui63 root, score: 96.149 N N N N
vg1102069789 C -> DEL N N silent_mutation Average:74.324; most accessible tissue: Minghui63 root, score: 96.149 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1102069789 C T -0.02 -0.01 -0.02 -0.01 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1102069789 NA 1.03E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 8.46E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 4.66E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 4.81E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 2.90E-07 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 3.52E-07 mr1607 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 9.34E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 4.51E-08 mr1835 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 2.70E-07 1.83E-13 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 1.97E-06 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 4.76E-06 mr1965 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 1.42E-07 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 2.14E-07 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 2.87E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 9.70E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 6.63E-08 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 1.84E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 2.57E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 1.74E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 3.83E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 6.24E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 4.75E-10 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 3.58E-06 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 4.52E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 2.80E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 4.46E-06 NA mr1835_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 8.28E-06 3.17E-09 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 4.36E-14 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 1.64E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102069789 NA 3.85E-11 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251