Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102066617:

Variant ID: vg1102066617 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 2066617
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AGTGGCTCGAAGTCCATCCCGATTTTGGCTAGTAAGCTCGGCACTTTCCCATGTTTAATCTTTGGCCCATTTCACCATTTGGTCTGGACACAATCTGGCC[C/T,A]
GGTTATATATGCTTGGGCCGAGGTTACACTGGTACACAATTTTCCCTTGTATTTTTCACAAGGAATAAGTCCACTTTGACTCCCTTGCAAAACCGGATAT

Reverse complement sequence

ATATCCGGTTTTGCAAGGGAGTCAAAGTGGACTTATTCCTTGTGAAAAATACAAGGGAAAATTGTGTACCAGTGTAACCTCGGCCCAAGCATATATAACC[G/A,T]
GGCCAGATTGTGTCCAGACCAAATGGTGAAATGGGCCAAAGATTAAACATGGGAAAGTGCCGAGCTTACTAGCCAAAATCGGGATGGACTTCGAGCCACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.80% 18.10% 0.02% 0.00% A: 0.02%
All Indica  2759 75.60% 24.40% 0.04% 0.00% A: 0.04%
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 41.60% 58.40% 0.00% 0.00% NA
Indica I  595 20.70% 79.20% 0.17% 0.00% NA
Indica II  465 95.30% 4.70% 0.00% 0.00% NA
Indica III  913 97.80% 2.10% 0.00% 0.00% A: 0.11%
Indica Intermediate  786 79.60% 20.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1102066617 C -> T LOC_Os11g04840.1 upstream_gene_variant ; 3229.0bp to feature; MODIFIER silent_mutation Average:97.267; most accessible tissue: Zhenshan97 root, score: 98.37 N N N N
vg1102066617 C -> T LOC_Os11g04850.1 upstream_gene_variant ; 84.0bp to feature; MODIFIER silent_mutation Average:97.267; most accessible tissue: Zhenshan97 root, score: 98.37 N N N N
vg1102066617 C -> T LOC_Os11g04850.2 upstream_gene_variant ; 68.0bp to feature; MODIFIER silent_mutation Average:97.267; most accessible tissue: Zhenshan97 root, score: 98.37 N N N N
vg1102066617 C -> T LOC_Os11g04860.1 downstream_gene_variant ; 1110.0bp to feature; MODIFIER silent_mutation Average:97.267; most accessible tissue: Zhenshan97 root, score: 98.37 N N N N
vg1102066617 C -> T LOC_Os11g04850-LOC_Os11g04860 intergenic_region ; MODIFIER silent_mutation Average:97.267; most accessible tissue: Zhenshan97 root, score: 98.37 N N N N
vg1102066617 C -> A LOC_Os11g04840.1 upstream_gene_variant ; 3229.0bp to feature; MODIFIER silent_mutation Average:97.267; most accessible tissue: Zhenshan97 root, score: 98.37 N N N N
vg1102066617 C -> A LOC_Os11g04850.1 upstream_gene_variant ; 84.0bp to feature; MODIFIER silent_mutation Average:97.267; most accessible tissue: Zhenshan97 root, score: 98.37 N N N N
vg1102066617 C -> A LOC_Os11g04850.2 upstream_gene_variant ; 68.0bp to feature; MODIFIER silent_mutation Average:97.267; most accessible tissue: Zhenshan97 root, score: 98.37 N N N N
vg1102066617 C -> A LOC_Os11g04860.1 downstream_gene_variant ; 1110.0bp to feature; MODIFIER silent_mutation Average:97.267; most accessible tissue: Zhenshan97 root, score: 98.37 N N N N
vg1102066617 C -> A LOC_Os11g04850-LOC_Os11g04860 intergenic_region ; MODIFIER silent_mutation Average:97.267; most accessible tissue: Zhenshan97 root, score: 98.37 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1102066617 C A -0.09 -0.14 -0.1 -0.08 -0.06 -0.07
vg1102066617 C T -0.09 -0.13 -0.1 -0.08 -0.07 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1102066617 NA 1.74E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 NA 8.85E-06 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 NA 6.12E-12 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 NA 1.17E-07 mr1835 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 2.27E-10 1.03E-23 mr1904 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 8.09E-09 5.04E-15 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 NA 1.41E-06 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 NA 5.95E-09 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 NA 5.90E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 NA 1.50E-09 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 NA 1.13E-09 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 NA 1.43E-06 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 NA 5.59E-11 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 NA 5.38E-09 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 NA 9.47E-07 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 NA 2.55E-10 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 NA 1.03E-07 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 NA 8.13E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 NA 1.06E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 NA 8.70E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 1.04E-07 1.41E-17 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 4.47E-07 4.32E-11 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 NA 1.87E-07 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 4.40E-06 1.12E-20 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102066617 NA 8.87E-12 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251