Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102045515:

Variant ID: vg1102045515 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 2045515
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGGAAATACATATATGTATTTGAGTCAAGTTTTAAATTTGTTCGTTTTTTAAAATACAGAAGGAGTCGTATAAGAAATCTTTTTAGAAAAACTCGCAT[G/A]
CTAACTTGAGCTGATCGGACTTCTAATTGCAACTCATGATTTTCTAGAAAAATATATATCCAAGCGAATTCCCACAGTAAATTTCACCTTAACTAAACTA

Reverse complement sequence

TAGTTTAGTTAAGGTGAAATTTACTGTGGGAATTCGCTTGGATATATATTTTTCTAGAAAATCATGAGTTGCAATTAGAAGTCCGATCAGCTCAAGTTAG[C/T]
ATGCGAGTTTTTCTAAAAAGATTTCTTATACGACTCCTTCTGTATTTTAAAAAACGAACAAATTTAAAACTTGACTCAAATACATATATGTATTTCCAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.80%	17.90%	0.21%	0.17%	NA
All Indica	2759	75.90%	23.80%	0.29%	0.00%	NA
All Japonica	1512	99.20%	0.50%	0.00%	0.26%	NA
Aus	269	40.10%	59.10%	0.74%	0.00%	NA
Indica I	595	21.30%	78.50%	0.17%	0.00%	NA
Indica II	465	95.30%	4.50%	0.22%	0.00%	NA
Indica III	913	97.80%	2.10%	0.11%	0.00%	NA
Indica Intermediate	786	80.20%	19.20%	0.64%	0.00%	NA
Temperate Japonica	767	99.50%	0.00%	0.00%	0.52%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	7.30%	0.00%	2.08%	NA
Intermediate	90	84.40%	13.30%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1102045515	G -> A	LOC_Os11g04790.1	downstream_gene_variant ; 462.0bp to feature; MODIFIER	silent_mutation	Average:37.701; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg1102045515	G -> A	LOC_Os11g04800.1	downstream_gene_variant ; 728.0bp to feature; MODIFIER	silent_mutation	Average:37.701; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg1102045515	G -> A	LOC_Os11g04790-LOC_Os11g04800	intergenic_region ; MODIFIER	silent_mutation	Average:37.701; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg1102045515	G -> DEL	N	N	silent_mutation	Average:37.701; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1102045515	NA	8.08E-10	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	NA	6.60E-06	mr1686	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	NA	3.87E-11	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	NA	2.01E-07	mr1835	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	1.95E-10	1.06E-23	mr1904	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	3.40E-09	1.88E-15	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	NA	1.46E-06	mr1942	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	NA	2.95E-09	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	NA	1.80E-07	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	NA	6.05E-08	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	NA	3.69E-09	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	NA	1.64E-09	mr1265_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	NA	1.45E-06	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	NA	1.23E-10	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	NA	1.21E-08	mr1528_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	NA	9.62E-07	mr1558_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	NA	9.90E-11	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	NA	2.64E-07	mr1593_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	NA	5.78E-10	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	NA	1.33E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	NA	8.97E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	8.06E-07	1.23E-16	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	3.37E-06	2.93E-10	mr1835_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	NA	2.71E-07	mr1838_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	NA	5.42E-20	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515	NA	2.97E-11	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251