\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102045515:

Variant ID: vg1102045515 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 2045515
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGGAAATACATATATGTATTTGAGTCAAGTTTTAAATTTGTTCGTTTTTTAAAATACAGAAGGAGTCGTATAAGAAATCTTTTTAGAAAAACTCGCAT[G/A]
CTAACTTGAGCTGATCGGACTTCTAATTGCAACTCATGATTTTCTAGAAAAATATATATCCAAGCGAATTCCCACAGTAAATTTCACCTTAACTAAACTA

Reverse complement sequence

TAGTTTAGTTAAGGTGAAATTTACTGTGGGAATTCGCTTGGATATATATTTTTCTAGAAAATCATGAGTTGCAATTAGAAGTCCGATCAGCTCAAGTTAG[C/T]
ATGCGAGTTTTTCTAAAAAGATTTCTTATACGACTCCTTCTGTATTTTAAAAAACGAACAAATTTAAAACTTGACTCAAATACATATATGTATTTCCAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.80% 17.90% 0.21% 0.17% NA
All Indica  2759 75.90% 23.80% 0.29% 0.00% NA
All Japonica  1512 99.20% 0.50% 0.00% 0.26% NA
Aus  269 40.10% 59.10% 0.74% 0.00% NA
Indica I  595 21.30% 78.50% 0.17% 0.00% NA
Indica II  465 95.30% 4.50% 0.22% 0.00% NA
Indica III  913 97.80% 2.10% 0.11% 0.00% NA
Indica Intermediate  786 80.20% 19.20% 0.64% 0.00% NA
Temperate Japonica  767 99.50% 0.00% 0.00% 0.52% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 7.30% 0.00% 2.08% NA
Intermediate  90 84.40% 13.30% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1102045515 G -> A LOC_Os11g04790.1 downstream_gene_variant ; 462.0bp to feature; MODIFIER silent_mutation Average:37.701; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg1102045515 G -> A LOC_Os11g04800.1 downstream_gene_variant ; 728.0bp to feature; MODIFIER silent_mutation Average:37.701; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg1102045515 G -> A LOC_Os11g04790-LOC_Os11g04800 intergenic_region ; MODIFIER silent_mutation Average:37.701; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg1102045515 G -> DEL N N silent_mutation Average:37.701; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1102045515 NA 8.08E-10 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 NA 6.60E-06 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 NA 3.87E-11 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 NA 2.01E-07 mr1835 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 1.95E-10 1.06E-23 mr1904 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 3.40E-09 1.88E-15 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 NA 1.46E-06 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 NA 2.95E-09 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 NA 1.80E-07 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 NA 6.05E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 NA 3.69E-09 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 NA 1.64E-09 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 NA 1.45E-06 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 NA 1.23E-10 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 NA 1.21E-08 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 NA 9.62E-07 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 NA 9.90E-11 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 NA 2.64E-07 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 NA 5.78E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 NA 1.33E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 NA 8.97E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 8.06E-07 1.23E-16 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 3.37E-06 2.93E-10 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 NA 2.71E-07 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 NA 5.42E-20 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102045515 NA 2.97E-11 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251