Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101991503:

Variant ID: vg1101991503 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 1991503
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 336. )

Flanking Sequence (100 bp) in Reference Genome:


TTATGCGCAAAAGACTGTGGCATGATATTATTCACTCTGTCTTGCAGGTCAAACAGAGAGTTTCTATATCATATTCTAGAGGAAGTCATAAAAGCTGGAG[C/G]
AACAACACTCAATATCCCAGACACTGTTGGATACACTCTTCCTTATGAATTTGGGAAGCTAATTGCTGATATAAAAGCAAACACTCCAGGAATTGAAAAT

Reverse complement sequence

ATTTTCAATTCCTGGAGTGTTTGCTTTTATATCAGCAATTAGCTTCCCAAATTCATAAGGAAGAGTGTATCCAACAGTGTCTGGGATATTGAGTGTTGTT[G/C]
CTCCAGCTTTTATGACTTCCTCTAGAATATGATATAGAAACTCTCTGTTTGACCTGCAAGACAGAGTGAATAATATCATGCCACAGTCTTTTGCGCATAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.70% 3.10% 0.19% 0.00% NA
All Indica  2759 99.20% 0.70% 0.04% 0.00% NA
All Japonica  1512 91.50% 8.10% 0.46% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.60% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 2.20% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 75.20% 23.80% 0.99% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1101991503 C -> G LOC_Os11g04670.1 missense_variant ; p.Ala259Gly; MODERATE nonsynonymous_codon ; A259G Average:39.358; most accessible tissue: Callus, score: 64.613 possibly damaging 1.815 DELETERIOUS 0.00
vg1101991503 C -> G LOC_Os11g04670.2 missense_variant ; p.Ala259Gly; MODERATE nonsynonymous_codon ; A259G Average:39.358; most accessible tissue: Callus, score: 64.613 possibly damaging 1.815 DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1101991503 2.56E-08 2.07E-10 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 2.78E-06 3.99E-09 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 5.05E-07 8.23E-09 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 7.30E-06 7.30E-06 mr1085 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 6.31E-06 1.04E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 7.46E-08 1.44E-08 mr1103 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 2.93E-07 NA mr1104 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 5.43E-07 5.43E-07 mr1204 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 1.29E-09 2.41E-10 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 4.68E-06 4.68E-06 mr1264 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 5.10E-06 1.62E-07 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 4.83E-12 1.28E-10 mr1411 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 1.45E-06 1.06E-07 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 6.64E-06 NA mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 NA 8.47E-06 mr1878 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 7.77E-07 4.03E-08 mr1949 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 6.95E-08 6.95E-08 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 7.82E-07 2.43E-10 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 NA 2.39E-08 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 NA 8.85E-06 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 1.54E-06 2.20E-07 mr1103_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 8.14E-07 1.69E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 3.73E-06 4.18E-07 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 NA 9.88E-06 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 NA 8.72E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 9.07E-08 5.51E-10 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101991503 NA 7.00E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251