\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101783832:

Variant ID: vg1101783832 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 1783832
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TATTGATTTTCCATTAAATCGGTGAACACATTAATTTTAACCATTAGATCTCTCTAAAATTCAAAATTCCGGTAGCCAGCACGTACTCCCTCCTAGCCAC[C/T]
CTCCAACTCTTCCCTTCTCTCTTATTTTTAGCTAACTTTTTCTATTATTTAGCTAACATAGATCTATCTTAAGATTTTGAAATTACGCTCATCTGGAAAA

Reverse complement sequence

TTTTCCAGATGAGCGTAATTTCAAAATCTTAAGATAGATCTATGTTAGCTAAATAATAGAAAAAGTTAGCTAAAAATAAGAGAGAAGGGAAGAGTTGGAG[G/A]
GTGGCTAGGAGGGAGTACGTGCTGGCTACCGGAATTTTGAATTTTAGAGAGATCTAATGGTTAAAATTAATGTGTTCACCGATTTAATGGAAAATCAATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.20% 21.10% 33.05% 3.60% NA
All Indica  2759 14.00% 32.70% 47.55% 5.84% NA
All Japonica  1512 97.20% 0.90% 1.85% 0.07% NA
Aus  269 18.20% 20.80% 57.99% 2.97% NA
Indica I  595 18.30% 4.20% 67.23% 10.25% NA
Indica II  465 12.30% 35.70% 46.67% 5.38% NA
Indica III  913 11.10% 49.00% 37.24% 2.74% NA
Indica Intermediate  786 15.00% 33.50% 45.17% 6.36% NA
Temperate Japonica  767 97.40% 0.90% 1.56% 0.13% NA
Tropical Japonica  504 96.80% 0.80% 2.38% 0.00% NA
Japonica Intermediate  241 97.10% 1.20% 1.66% 0.00% NA
VI/Aromatic  96 39.60% 17.70% 42.71% 0.00% NA
Intermediate  90 61.10% 11.10% 27.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1101783832 C -> T LOC_Os11g04295.1 upstream_gene_variant ; 2484.0bp to feature; MODIFIER silent_mutation Average:17.087; most accessible tissue: Zhenshan97 flower, score: 24.143 N N N N
vg1101783832 C -> T LOC_Os11g04300.1 intron_variant ; MODIFIER silent_mutation Average:17.087; most accessible tissue: Zhenshan97 flower, score: 24.143 N N N N
vg1101783832 C -> DEL N N silent_mutation Average:17.087; most accessible tissue: Zhenshan97 flower, score: 24.143 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1101783832 NA 8.50E-13 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 1.68E-08 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 1.51E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 4.02E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 3.43E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 3.56E-08 mr1131_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 6.45E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 6.55E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 6.17E-08 mr1199_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 6.68E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 1.57E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 9.67E-07 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 2.12E-07 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 5.25E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 4.74E-08 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 2.19E-07 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 6.16E-13 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 8.28E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 1.02E-11 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 5.58E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 3.92E-10 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 4.60E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 1.30E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 2.03E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 3.49E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 1.14E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 2.76E-15 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 3.71E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 2.32E-09 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101783832 NA 2.69E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251