Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101516781:

Variant ID: vg1101516781 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 1516781
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

TCCATGTTATTGATATATAAGTGTGAGACTAATGTTTACTCAAATGTTATCTTATTTAGTCTCATTTACATTGAGAACATGGAGATCATGAAGGTATATG[T/C]
TTTTATGTTGGTCTACATCATTACTACATATGCCTTCTCTATATGTATAGGATAAACCCCCATTGGTCATTCTCTAATTATGCATACACTTGCATCTCTT

Reverse complement sequence

AAGAGATGCAAGTGTATGCATAATTAGAGAATGACCAATGGGGGTTTATCCTATACATATAGAGAAGGCATATGTAGTAATGATGTAGACCAACATAAAA[A/G]
CATATACCTTCATGATCTCCATGTTCTCAATGTAAATGAGACTAAATAAGATAACATTTGAGTAAACATTAGTCTCACACTTATATATCAATAACATGGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.70%	9.70%	2.64%	62.95%	NA
All Indica	2759	2.60%	0.10%	1.88%	95.36%	NA
All Japonica	1512	67.10%	29.20%	0.20%	3.51%	NA
Aus	269	2.20%	0.00%	15.99%	81.78%	NA
Indica I	595	1.80%	0.20%	1.51%	96.47%	NA
Indica II	465	4.50%	0.20%	1.29%	93.98%	NA
Indica III	913	1.20%	0.00%	0.99%	97.81%	NA
Indica Intermediate	786	3.70%	0.30%	3.56%	92.49%	NA
Temperate Japonica	767	83.80%	13.30%	0.00%	2.87%	NA
Tropical Japonica	504	38.70%	56.90%	0.00%	4.37%	NA
Japonica Intermediate	241	73.00%	22.00%	1.24%	3.73%	NA
VI/Aromatic	96	36.50%	4.20%	28.12%	31.25%	NA
Intermediate	90	44.40%	10.00%	0.00%	45.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1101516781	T -> DEL	N	N	silent_mutation	Average:5.368; most accessible tissue: Minghui63 flag leaf, score: 9.254	N	N	N	N
vg1101516781	T -> C	LOC_Os11g03820.1	downstream_gene_variant ; 4269.0bp to feature; MODIFIER	silent_mutation	Average:5.368; most accessible tissue: Minghui63 flag leaf, score: 9.254	N	N	N	N
vg1101516781	T -> C	LOC_Os11g03830.1	intron_variant ; MODIFIER	silent_mutation	Average:5.368; most accessible tissue: Minghui63 flag leaf, score: 9.254	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1101516781	3.35E-06	NA	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101516781	9.22E-06	NA	mr1086	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101516781	2.47E-09	NA	mr1107	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101516781	NA	3.76E-06	mr1107	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251