Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1101287366:

Variant ID: vg1101287366 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 1287366
Reference Allele: C	Alternative Allele: T,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.33, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

CGTAGGTTTATATCAATCAATTATTAGCTTAAAGAGGATGATATACAGAATTCTATTCTGTGGACCAAACGGAACCTTGATGGTTTGAGGACAGTCCCTT[C/T,A]
AATGATATACAAATCAAATATTTTCTTGTGTCCTTGAGAAATTTGGAAGACGCACTGTTAAAATCCATGTCTTTTTTGCTATGCATGGCTGATGTGGACT

Reverse complement sequence

AGTCCACATCAGCCATGCATAGCAAAAAAGACATGGATTTTAACAGTGCGTCTTCCAAATTTCTCAAGGACACAAGAAAATATTTGATTTGTATATCATT[G/A,T]
AAGGGACTGTCCTCAAACCATCAAGGTTCCGTTTGGTCCACAGAATAGAATTCTGTATATCATCCTCTTTAAGCTAATAATTGATTGATATAAACCTACG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.40%	33.40%	0.13%	0.06%	A: 0.04%
All Indica	2759	98.80%	1.00%	0.11%	0.11%	NA
All Japonica	1512	3.30%	96.60%	0.00%	0.00%	A: 0.13%
Aus	269	91.10%	8.60%	0.37%	0.00%	NA
Indica I	595	99.20%	0.50%	0.34%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	99.50%	0.30%	0.11%	0.11%	NA
Indica Intermediate	786	97.80%	1.90%	0.00%	0.25%	NA
Temperate Japonica	767	3.00%	96.70%	0.00%	0.00%	A: 0.26%
Tropical Japonica	504	3.00%	97.00%	0.00%	0.00%	NA
Japonica Intermediate	241	5.00%	95.00%	0.00%	0.00%	NA
VI/Aromatic	96	74.00%	26.00%	0.00%	0.00%	NA
Intermediate	90	52.20%	45.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1101287366	C -> T	LOC_Os11g03400.1	upstream_gene_variant ; 1075.0bp to feature; MODIFIER	silent_mutation	Average:39.773; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg1101287366	C -> T	LOC_Os11g03410.1	downstream_gene_variant ; 1338.0bp to feature; MODIFIER	silent_mutation	Average:39.773; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg1101287366	C -> T	LOC_Os11g03400-LOC_Os11g03410	intergenic_region ; MODIFIER	silent_mutation	Average:39.773; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg1101287366	C -> A	LOC_Os11g03400.1	upstream_gene_variant ; 1075.0bp to feature; MODIFIER	silent_mutation	Average:39.773; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg1101287366	C -> A	LOC_Os11g03410.1	downstream_gene_variant ; 1338.0bp to feature; MODIFIER	silent_mutation	Average:39.773; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg1101287366	C -> A	LOC_Os11g03400-LOC_Os11g03410	intergenic_region ; MODIFIER	silent_mutation	Average:39.773; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg1101287366	C -> DEL	N	N	silent_mutation	Average:39.773; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1101287366	NA	1.83E-20	Yield	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1101287366	NA	1.06E-25	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101287366	3.72E-06	3.72E-06	mr1655	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101287366	NA	1.17E-86	mr1758	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101287366	NA	8.80E-81	mr1027_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101287366	NA	2.87E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101287366	NA	2.44E-15	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101287366	NA	4.56E-13	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251