\
| Variant ID: vg1101201264 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 1201264 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.57, A: 0.43, others allele: 0.00, population size: 101. )
GAAAAGGTGCCTAAATCAAACCAAGGTGAATTAGGAGGTGGGGATTTACAACGAATCTTCTAATGAGGGGGCATCTCTCAAACTCAGAGTGATATTTGAG[A/G]
GTGGTTTTTGCAATTTTCCCTTAAAAATAAAACACAGTGTTGCCCATATGACAGGCAGCAAGCTAGCAGTAACCAAATGATATATACGTGTGGCATAAGA
TCTTATGCCACACGTATATATCATTTGGTTACTGCTAGCTTGCTGCCTGTCATATGGGCAACACTGTGTTTTATTTTTAAGGGAAAATTGCAAAAACCAC[T/C]
CTCAAATATCACTCTGAGTTTGAGAGATGCCCCCTCATTAGAAGATTCGTTGTAAATCCCCACCTCCTAATTCACCTTGGTTTGATTTAGGCACCTTTTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.80% | 35.10% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 87.70% | 12.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 2.70% | 97.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.40% | 94.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 44.40% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1101201264 | A -> G | LOC_Os11g03260.1 | upstream_gene_variant ; 3433.0bp to feature; MODIFIER | silent_mutation | Average:37.255; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1101201264 | A -> G | LOC_Os11g03270.1 | upstream_gene_variant ; 1476.0bp to feature; MODIFIER | silent_mutation | Average:37.255; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1101201264 | A -> G | LOC_Os11g03260-LOC_Os11g03270 | intergenic_region ; MODIFIER | silent_mutation | Average:37.255; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1101201264 | NA | 2.52E-38 | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101201264 | NA | 4.62E-07 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101201264 | NA | 3.45E-08 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101201264 | NA | 1.82E-07 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101201264 | NA | 7.45E-07 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101201264 | NA | 3.25E-07 | mr1518 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101201264 | NA | 3.63E-18 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101201264 | NA | 9.43E-11 | mr1023_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101201264 | NA | 3.83E-12 | mr1132_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101201264 | NA | 1.32E-12 | mr1178_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101201264 | 6.95E-07 | NA | mr1380_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101201264 | NA | 1.95E-14 | mr1529_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101201264 | 4.88E-07 | NA | mr1561_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101201264 | 2.60E-07 | NA | mr1908_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101201264 | 3.19E-06 | 1.88E-06 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |